分子生物學(xué)和同工酶電泳法鑒定煙粉虱幼期寄生蜂淺黃恩蚜小蜂

張曉曼，徐紅星，王 甦，ABID Ali，張 帆*

(1.北京農(nóng)學(xué)院植物科學(xué)技術(shù)學(xué)院，北京 102206;2.北京市農(nóng)林科學(xué)院植物保護(hù)環(huán)境保護(hù)研究所，北京 100097;3.中國(guó)農(nóng)業(yè)科學(xué)院植物保護(hù)研究所，北京 100193)

Introduction

Bemisia tabaci Genn.(Homoptera:Aleyrodidae:Aleyrodinae)is an important pest of cotton，vegetables，and ornamental plants all over the world(Servin－Villegas et al.，2001;De Barro et al.，2011).It was recorded in China for the first time in 1949(Zhou，1949).The cotton whitefly was regarded as a secondary pest until 1980s(Byrne et al.，1990)and in the last two decades it was regarded as a primary pest(Schuster，2003)because of its wide host－range，higher fecundity and the development of resistance to insecticides(Palumbo et al.，2001，2003;Ahmad et al.，2002;Nauen and Denholm，2005;Jones，2003).The cotton whitefly causes damage directly by feeding and indirectly by the transmission of pathogens on plants(Byrne et al.，2000).There is need of alternative or supplementary strategies to control B.tabaci as it has developed resistance to insecticides(Palumbo et al.，2001，2003;Ahmad et al.，2002;Nauen and Denholm，2005).Many parasitoid species in the genera of Encarsia(Hymenoptera:Aphelinidae)are important natural enemies of the two whitefly species(Gerling，1998).Over 170 species in the genus Encarsia have been described worldwide(Hayat，1989).Encarsia sophia Girault ＆ Dodd［=E.transvena(Timberlake)］(Hymenoptera:Aphelinidae)］is one of the most important parasitoid species parasitizing many whitefly species，including B.tabaci(Kapadia and Puri，1990;Gerling et al.，1998;Hunter ＆Kelly，1998;Antony et al.，2003;Zang ＆ Liu，2008，2009;Shi et al.，2009).Female eggs are laid internally in whitefly nymphs and develop as primary parasitoids.There are many species of B.tabaci nymphal parasitoids(Wang et al.，2011)but it is only well documented in literature.Compared to E.Sophia，reproductive technology of E.formosa had achieved remarkable importance as nymphal parasitoid in case of whitefly(Cheng et al.，1986).But under laboratory conditions it has been evaluated that E.sophia have a higher competitiveness than E.formosa.E.sophia is a potentially useful nymphal parasitoid of B.tabaci at present(Li et al.，2008;Anyony et al.，2003).So it is important to work on the identification of this parasitoid at nymphal stages of B.tabaci.There are some traditional methods for the identification of B.tabaci nymphal parasitoids which are based on dissection or rearing of the parasitoids until they emerged.These both methods not only consumed much time and needed more skilled labor but also have low rate of success.Electrophoresis iso－enzyme method had been successively used to identify another nymphal parasitoid，E.bimaculata of B.tabaci(Antony，2004)but not studied against E.sophia.By looking at the biology of this parasitoid it is important to find out a rapid and accurate method to detect the E.sophia parasitization at earlier stages of B.tabaci nymphs.

Keeping this importance in view，it has been decided to use molecular(PCR)and iso－enzymeatic method for the identification of nymphal parasitoid，E.sophia in B.tabaci nymphs.

Materials and methods

1.Host plants and Insects culture

Host plants:Bt－cotton(Gossypium hirsutum)seed of jiyou－768 variety was provided by Institute of Vegetable Research，Beijing Academy of Agriculture and Forestry Sciences(BAAFS).The cotton seedlings were grown in 12 cm diameter plastic flower pots in greenhouse inside glass cages(60×40 cm)under 25～30℃，RH 60%～70% and 16L∶8D photoperiod.

B.tabaci:whiteflies used in all experiments were collected from the Institute of Plant and Environment Protection(BAAFS)where it was reared on cotton plants.

E.Sophia:individuals used in the trials were provided by the Department of Entomology，Agricultural Experiment Station，Texas A ＆ M University，USA where it was cultured on B.tabaci nymphs as host.

Experimental Arena:Cotton leaves with E.sophia pupae were detached and shifted into experimental arena as shown in Fig.1.Each petri dish(9 cm diameter)has a hole(4 cm dm)on upper lid and gauzed by muslin cloth to provide ventilation while at the bottom of each petri dish，two pieces of 9cm diameter filter paper were placed to maintain the moisture for detached leaves.A 5×2 cm soaked cotton wool strip was used as paste on the stems of detached leaves to keep moisture constant.After adult insect emergence，both male and female E.sophia were isolated and shifted separately and then they were fed with honey－water solution(10%)for 24 hours.Mated females were released into the petri dish with non－parasitized third nymphal instar of B.tabaci.Parasitic B.tabaci nymphs inside E.Sophia were used as experimental material(Zhou et al.，2010;Szabo et al.，1993)，single detection and each sample repeated 10 times.Adult parasitoids of E.formosa and E.sophia were reared and collected under the same environmental conditions as mentioned above.Collection methods of experimental insects are given in table 1.

Table 1 The situation of test insect

2 PCR detection

2.1Genomic DNA isolation

Dissection of EB0，EB1，EB2，EB3 and EB4 stages(see detail in table 1)was directly under the Motic－microscope and if parasitoids identified at the corresponding stages，they were provoked in the centrifuge tube(1.5 mL)respectively by the anatomy needle and stored at－20℃until they were used in experiments.The total DNA was extracted by TIANamp Genomic DNA Kit(TAKATA).

2.2PCR amplification

PCR products were conservative sequences of cytochrome oxidase I gene.LA Taq polymerase and dNTP bought from Takara.Specific primers of E.sophia that we designed based on the inter－comparison of E.sophia and B.tabaci COI gene sequence.We used universal primer(Forward primer sequence c1－j－2183F:5'－CAACATTTATTTTGA TTTTTTGG－3' and Reverse primer sequence L2－N－3014R:5'－TCCAATGCACTAATCTGCCATATTA－3')to attain their COI genes sequence of E.sophia and B.tabaci，then sequencing(Sanboyuanzhi Biotechnology Co.，Ltd in Beijing).CLUSTALW2 was used to compare the two sequences，at last we got the specific primers of E.sophia:Forward primer AE42F:5'－TGGGGTTATAGGAATG－3' and Reverse primer AE669R:5'－AACTAATCCCTCC CAG－3'.Show it in Figure 1.

Fig.1 Partial alignments of sequence COI gene，Encarsia sophia sequence identity compared with Bemisia tabaci.

The reaction mixture(25μL volume)contained LaTaq polymerase 0.5μL(5 u/μL)17μL ddH2O，2μL dNTP(2.5 mM 400μL)，2.5μL 10×bufferⅡ(Mg2+plus)，1μL of each primer and 1μL of template DNA.The PCR cycling involved pre－denaturation(94℃for 5 min)，initial denaturation at 94℃ for 45 s，annealing at 50℃ for 45 s，with elongation at 72℃for 1min，followed by 35 cycles of step 2 to the end step，and then stored at 4℃.The PCR product was analyzed by gel electrophoresis using 1% agarose and PowerPac Universal electrophoresis(American Bio－Rad.Gel.DOCTMXR+)，1×TAE buffer，voltage 95V，after 30 min it was analysed by gel imaging system(American Bio－Rad).5 kb DNA Ladder(trans 2 K plus)and DL 2 kb DNA Ladder were used as marker to analyse the size of the PCR products.

3.Isozyme electrophoretic detection

Esterase isozyme electrophoretic was used in vertical slab polyacrylamide gel electrophoresis tests.Single insect was shifted in each centrifuge tube(1.5 cm)，samples were homogenized with homogenate buffer(pH 6.8)，and then 5μL bromophenol blue indicator solution was added and mixed to get the suspensions.The condition of electrophoretic:stacking gel(5%)，superposed on 8% resolving gel，electrophoresis buffer(pH 8.2)，current of 25 mA.Esterases were visualized by the staining of 0.005% 1－naphthyl acetate，0.2 M phosphate buffer(pH 6.6)and fast blue RR salt(100 mg/100mL).Gels were photographed and analyzed by gel imaging system(American Bio－Rad.Gel.DOCTMXR+).

Results

1.The result of PCR detection

PCR was able to accurately identify the E.sophia parasitized B.tabaci nymph as early as 1 hour after spawning.Figure 2 shows that there was a band at 627 bp when E.sophia parasitize B.tabaci nymphs.After sequencing and comparing by the sequence of NCBI BLAST website，it was exactly similar to E.sophia M95107 cytochrome oxidase subunit I(COI)gene(GenBank:AY264338)，similar rate reached to 99%.There are three different bases of ES1 and ES2 sequence(Figure 1)，maybe they are different individuals or at different instars.Figure2 shows that non－parasitized B.tabaci nymphs did not show bands.We also used the same specific primer of E.Sophia to identify E.fromosa，the result showed that there is no band at 627 bp，so this pair of primers could distinguish early instars of E.Sophia and E.fromosa by PCR detection.

Fig.2 PCR detection of Encarsia sophia(A)and Encarsia formosa(B)parasitized and non－parasitized Bemisia tabaci nymphs

2.The result of Isozyme electrophoretic detection

Fig.3 shows the esterase－banding pattern of non－parasitized and E.sophia parasitized B.tabaci nymphs.Non－parasitized B.tabaci and EB2，EB1，EB0 strain had three bands while EB4，EB3(mR:0.021 and 0.064)had two esterase bands.The esterase electrophoretic could only detect the later larvae of E.sophia parasitized B.tabaci nymphs.Only when E.sophia develops to the third instar or later，this method of detection E.Sophia parasitized and non－parasitized B.tabaci nymphs can work.Map shows the relative mobility rate(mR)where mR is the distance from protein samples to the sample(cm)divided by the distance from bromophenol blue to the sample(cm).

The results showed that PCR could be more effective than electrophoretic for the detection of E.sophia parasitized and non－parasitized B.tabaci nymphs，because it could distinguish the early parasitoid while Esterase electrophoretic could only detect B.tabaci nymphs inside E.sophia developing to third instar，prepupa and pupa.The reasons for different mR of the two B0 fastest band in Fig.3 was might be the two B0 at different developmental stages.The two methods were compared in the table 2.

Fig.3 Esterase－banding pattern of unparasitized and Encarsia sophia parasitized Bemisia tabaci nymphs.

Discussion

In recent years，molecular biology developed rapidly，DNA barcoding technique could indentify species at different development stages(Ahrens et al.，2007).All the molecular identification of parasitoids are based on adult detection(Qiu，2005;Babcock and Heraty，2000;De León et al.，2010).It is the first report in our knowledge to use molecular identification to detect E.sophia parasitized and nonparasitized B.tabaci nymphs.

Antony et al.used electrophoresis to detect E.bimaculata parasitized and non－parasitized B.tabaci nymphs and considered that electrophoresis might make it possible to detect E.bimaculata at earlier stage(2004).However，our results showed that electrophoresis could only detect the B.tabaci parasitoids in the late larval instar(third instar and pupa).Lisha et al.(2003)reported that there were two fast moving and a slow band in cassava strain for esterase in a non－parasitized B.tabaci.Our results are consistent with the results reported in his paper.Compared with isoenzyme electrophoresis methods，PCR methods have more advantages such as rapid，accurate，efficient and so on.We used COI gene as an identified fragment gene to compare with other fragment genes，COI gene has some advantages such as relatively conservative，enough variation and the length of sequence is moderate(Hebert et al.，2003).It could detect the early larvae of E.sophia parasitized B.tabaci nymphs.PCR could detect E.sophia parasitized B.tabaci nymphs rapidly，accurately and it is better than isozymes electrophoresis，dissection and rearing to parasitoid emergence.This method could detect the parasitoid rate in laboratory.In natural environment it would be used to assess the parasitic effect even the parasitoids were at the egg stage and it also would save both a lot of time and cost of labor.The PCR analysis system could provide a potential method for other parasitoids species identification and parasitic effect evaluation.

Acknowledgements

We thank Dr.Wei Shu-Jun from Beijing Academy of Agriculture and Forestry Sciences，China and Dr.Gao Fei from Zhejiang A＆F University，China，for valuable comments.This paper was funded by the National Basic Research and Development Program of China(2009CB119200)，the Special Fund for Agro-scientific Research in the Public Interest(2013CB127605).

Fig.4 Experimental design for getting the material to molecular experiments

Ahmad M，Arif MI，Ahmad Z，Denholm I，2002.Cotton whitefly(Bemisia tabaci)resistance to organophosphate and pyrethroid insecticides in Pakistan.Pest Manag.Sci.，58(2):203－208.

Ahrens D，Monaghan MT，Vogler AP，2007.DNA－based taxonomy for associating adults and larvae in multi－species assemblages of chafers(Coleoptera:Scarabaeidae).Mol.Phylogenet.Evol.，44(1):436－449.

Antony B，Palaniswami MS，Kirk AA，Henneberry TJ，2004.Development of Encarsia bimaculata(Heraty and Polaszek)(Hymenoptera:Aphelinidae)in Bemisia tabaci(Gennadius)(Homoptera:Aleyrodidae)nymphs.Biol.Control，30:546－555.

Antony B，Palaniswami MS，Henneberry TJ，2003.Encarsia transvena(Hymenoptera:Aphelinidae)Development on Different Bemisia tabaci Gennadius(Homoptera:Aleyrodidae)Instars.Environ.Entomol.，32(3):584－591.

Babcock CS，Heraty JM，2000.Molecular markers distinguishing Encarsia formosa and Encarsia luteola(Hymenoptera: Aphelinidae).Ann.Entomol.Soc.Am.，93(4):738－744.

Byrne DN，Cohen AC，Draeger EA，1990.Water uptake from plant tissue by the eggs pedicel of the green house whitefly，Trialeurodes vaporariorum(Homo－ptera:Aleyrodidae).Can.J.Zool.，68:1193－1195.

Byrne FJ，Gorman KJ，Cahill M，Denholm I，Devonshire AL，2000.The role of B－type esterases in conferring insecticide resistance in the tobacco whitefly，Bemisia tabaci(Genn).Pest Manag.Sci.，56(10):867－874.

Cheng HK，Tian LQ，Wei BC，Zhao JH，Ye CQ，Wei SX，Wang JZ，Wang RP，1989.A technique for commercial－scale production of Encarsia Formosa.Chin.J.Boil.Control，5(4):178－181.

De Barro PJ，Hart PJ，2000.Mating interactions between two biotypes of the whitefly，Bemisia tabaci(Hemiptera:Aleyrodidae)in Australia.Bull.Entomol，Res.90(2):103－112.

De Barro PJ，Liu SS，Boykin LM，Dinsdale AB，2011.Bemisia tabaci:A Statement of Species Status.Annu.Rev.Entomol.，56:1－19.

De León JH，Neumann G，F(xiàn)ollett PA，Hollingsworth RG，2010.Molecular markers discriminate closely related species Encarsia diaspidicola and Encarsia berlesei(Hymenoptera:Aphelinidae):biocontrol candidate agents for White Peach Scale in Hawaii.J.Econ.Entomol.，103(3):908－916.

Gerling D，Quicke DLJ，Orion T，1998.Oviposition mechanisms in the whitefly parasitoids Encarsia transvena and Eretmocerus mundus.Biol.Control，43(3):289－297.

Hayat M，1989.A revision of the species of Encarsia foester(Hymenoptera:Aphelinidae)from India and the adjacentcountries.Oriental Insects，23:1－31.

Hebert PDN，Ratnasingham S，deWaard JR，2003.Barcoding animal life:cytochrome c oxidase subunit 1 divergences among closely related species.Proc.R.Soc.Biol.Sci.Ser.B.，270:S96－S99.

Hoddle MS，van Driesche RG，Sanderson JP，1998.Biology and use of the whitefly parasitoid Encarsia formosa.Annu.Rev.Entomol.，43:645－669.

Hunter MS，Kelly SE，1998.Hyperparasitism by an exotic autoparasitoid:secondary host selection and the win－dow of vulnerability of conspecific and native heterospecific hosts.Entomologia Experimentalis et Applicata，89(3):249－259.

Jones DR，2003.Plant viruses transmitted by whiteflies.Eur.J.Plant Pathol.，109(3):195－219.

Kapadia MN，Puri SN，1990.Development，relative pro－portions and emergence of Encarsia transvena(Timberlake)and Eretmocerus mundus Mercet，important parasitoids of Gennadius.Entomon.，15(3－4):235－239.

Li YX，Luo C，Zhou CQ，Zhou SX，Zhang F，2008.Bionomics and host competition of two parasitoids on Bemisia tabaci.Acta Entomologica Sinica，51(7):738－744.

Lisha VS，Antony B，Palaniswami MS，Henneberry TJ，2003.Bemisia tabaci(Gennadius)(Homoptera:Aleyrodidae)biotypes in India.J.Ecol.Entomol.，96(2):322－327.

Nauen R，Denholm I，2005.Resistance of insect pests to neonicotinoid insecticides:current status and future prospects.Arch.Insect Biochem.Physiol.，58:200－215.

Palumbo JC，Horowitz AR，Prabhaker N，2001.Insecticidal control and resistance management for Bemisia tabaci.Crop Prot.，20(9):739－765.

Palumbo JC，Ellsworth PC，Dennehy TJ，Nichols RL，2003.Crosscommodity guidelines for neonicotinoid insecticides in Arizona.IPM Ser.17 Pub.AZ.17:13－19.

Qiu BL，Ren SX，Wen SX，2005.Application of molecular marker in taxonomy of aphelinid parasitoids(Hymenoptera:Aphelinidae)of Bemisia tabaci.Entomol.J.East China，14(1):5－8.

Ramya R，Nagarajan T，Sivakumar V，Senthilkumar RL，Bala Obulapathi B，Thiagarajan D，Srinivasan VA，2009.Identification of cross－contaminated animal cells by PCR and isoenzyme analysis.Cytotechnology，61(3):81－92.

Schuster DJ，2003.Preference of Bemisia argentifolii(Homoptera:Aleyrodidae)for selected vegetable hosts.J.Agri Urban Entomol.，20(2):59－67.

Servin－Villegas R，Troyo－Dieguez E，Martinez－Carrillo JL，2001.Wild hosts of Bemisia argentifolii(Homoptera:Aleyrodidae)Bellows ＆ Perring in semiarid northwest Mexico.Southwestern Entomol.，26(3):239－244.

Shi SS，Zang LS，Liu TX，Yuan CC，Sun GZ，2009.Host－feeding behavior of parasitoids on hosts and implication for biological control.Acta Entomologia Sinica，52(4):424－433.

Szabo P，van Lenteren JC，Huisman PWT，1993.Development time，survival and fecundity of Encarsia formosa on Bamisia tabaci and Trialeurodes vaporariorum.Bulletin.Section Regionale Ouest Palaearctique，Organisation Internationale de Lutte Biologique，16(2):173－176.

Wang JH，Zhang F，Li YX，2011.Diversity of species and reproductive mode of Bemisia tabaci parasitoids.Chin.J.Boil.Control，27(1):115－123.

Zhou CQ，Li YX，Liu TX，Zhang F，Lou C，2010.Development and morphology of female immature of Encarsia sophia and their longevity and fecundity.Chin.J.Biol Control，26(2):113－118.

Zhou Y，1949.List of Chinese insect.Chin.J.Entomol.，3(4):1－18.

Zang LS，Liu TX，2008.Host feeding of three whitefly parasitoid species on Bemisia tabaci Biotype B，with impli－cations for whitefly biological control.Entomologia Experi－mentalis et Applicata，127(1):55－63.

Zang LS，Liu TX，2009.Food－deprived host－feeding parasitoids kill more pest insects.Biol.Control Science and Technology，19(6):573－583.