Comparing successful gene knock-in efficiencies of CRlSPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts

LlU Hui, LlU Chang, ZHAO Yu-hang, HAN Xue-jie, ZHOU Zheng-wei, WANG Chen, Ll Rong-feng, Ll Xue-ling

1 State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks, Inner Mongolia University, Hohhot 010070,P.R.China

2 Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.China

3 State Key Laboratories of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, P.R.China

4 Jiangsu Key Laboratory of Xenotransplantation, Nanjing Medical University, Nanjing 210029, P.R.China

1. lntroduction

Gene knockout mutations can create specific gene silencing at the DNA level and play an important role in biological research. Apart from homologous recombination (HR),zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9-based RNA-guided DNA endonucleases are new techniques for introducing genetic modifications into the genome (Zhaoet al. 2014). These technologies are able to introduce double-strand breaks (DSBs) into a specific gene locus.Using HR and nonhomologous end joining (NHEJ), cells are able to repair DNA damage. When cells utilize HR to repair DSBs, exogenous DNA can be integrated into the specific site. However, when cells repair DSBs through NHEJ, mutations can be produced by inserting or removing small fragments of DNA (Rouetet al. 1994).

All three of these genome-editing techniques have been successfully used in pig, cattle, sheep, and other livestock to introduce fixed-point modifications in the genome, improving meat quality, disease resistance, growth and development.ZFNs were first designed to cleave λDNA and reported by Kimet al. (1996). Since their discovrey, ZFNs have been used to edit the bovine β-lactoglobulin (BLG) gene (Yuet al. 2011), the β-casein gene (Liuet al. 2013, 2014), and the myostatin (MSTN) gene (Luoet al. 2014). The hybrid proteins composing TALENs and theFokI cleavage domain were later developed for efficient genome editing (Christianet al. 2010; Liet al. 2011; Milleret al. 2011). These TALENs have been used to successfully edit the bovine and sheepMSTNgene and bovine serum albumin gene for integration into the SP110 nuclear body protein at a specific locus of the bovine genome (Moghaddassiet al. 2014; Proudfootet al. 2015; Wuet al. 2015). The CRISPR/Cas9 system is a newly developed gene editing technology that can introduce DSBs into a specific gene locusviaCas9-guided sgRNA. Compared with ZFNs and TALENs, CRISPR/Cas9 not only has the advantage of specific DNA sequence recognition but also is more controlled and easier to operate to obtain homozygous mutants. Additionally, this system can simultaneously introduce multiple directed mutations at different sites. In domestic animals, CRISPR/Cas9 has been used to edit sheep and goatMSTN,BLG,PrP,andNUPgenes (Hanet al. 2014; Niet al. 2014), bovineNANOGand α-1,3-galactosyltransferase (GGTA1) genes,and the pigTYRgene (Satoet al. 2014; Heoet al. 2015;Zhouet al. 2015).

In this study, ZFNs and CRISPR/Cas9 were used to knock-in the humanizedFat-1(hFat-1) gene into the bovineMSTNgene locus. MSTN is a negative regulator of muscle growth and interruption of this gene can double the muscle content in animals. Additionally, TALENs and CRISPR/Cas9 were used to knock-in thehFat-1gene into the dairy goatβ-casein(CSN2) gene locus. β-Casein is a highly expressed protein in milk and is an ideal target for mammary gland enhancement. The gene targeting efficiency of different methods was compared. TheFat-1gene was obtained fromCaenorhabditis elegansand encodes a ω-3 fatty acid saturase. This gene product regulates ω-3 polyunsaturated fatty acids (PUFAs) production from the 18- to 20-carbon (C) through a dehydrogenation reaction(Spychallaet al. 1997). The ω-3 PUFAs enzyme influences cell proliferation, growth, apoptosis, and signal transduction.In this study, we created knock-inFat-1gene insertion in the bovineMSTNlocus and in the goatCSN2locus in order to increase the ω-3 PUFAs in meat and milk products.The aim of this study was to knock-in thehFat-1gene into the bovineMSTNgene and dairy goatCSN2gene loci infibroblasts and compare the success efficiency of different gene editing methods.

2. Materials and methods

2.1. Materials

All chemicals were purchased from Sigma-Aldrich (USA)unless otherwise indicated. A ZFN pair in plasmid form was synthesized using the Custom CompoZr Kit (Sigma-Aldrich,USA). Plasmids bearing the TALENs sequences were synthesized by Life Technologies (USA). PCR primers were created by the Beijing Genomics Institute (Beijing, China).Dulbecco’s modified Eagle medium (DMEM), Opti-MEM,0.25% trypsin, and Pen/Strep solution were purchased from Gibco (NY, USA). Tks Gflex DNA polymerase was purchased from TaKaRa (Japan). Standard fetal bovine serum and Dulbecco’s phosphate-buffered saline were obtained from Hyclone (UT, USA). The followings were purchased from Corning (NY, USA): 12-, 24-, and 96-well plates; 60- and 100-mm culture dishes; 2-mL tubes; and cell shove. A NEPA21 electroporator was purchased from NEPA GENE (Japan). Flow cytometer was purchased from Beckman Coulter (USA).

2.2. Preparation of donor plasmids and ZFNs,TALENs, or CRlSPR/Cas9

The ZFN plasmid pair was used to recognize the sequence CTCATCAAACCCATGAaagacggTACAAGGTATACTGG(uppercase letters denote ZFN recognition sites and the lowercase letters denoteFokI cutting sites) located in the second exon of theMSTNgene. The CRISPR/Cas9-bearing plasmid was also designed to target the second exon ofMSTNgene using the following gRNA sequence: GGATTTT GAAGCTTTTGGATggg (lowercase letters denote PAM).The TALENs plasmid was used to recognize the sequence TTCCTCATCTTCCCATTCACAGGAATCGAGagccatgaag GTCCTCATCCTTGCCTGTCTGGTGGCTCTG (uppercase letters denote TALE recognition sites and the lowercase letters denote theFokI cutting site) located in the second exon ofβ-casein(CSN2) gene. The CRISPR/Cas9 was also designed to target the second exon of theCSN2gene using the following gRNA sequence: CCTCATCCTTGCCTGTCTGGtgg (the lowercase letters denote PAM). Donor plasmids were constructed in the GFP-PGK-NeoR plasmid background,including a 5′ and 3′ homologous arm flanking the genes humanFat-1(hFat-1) or enhanced green fluorescent protein(eGFP), in which CAG was used as a promoter. TheeGFPandhFat-1donor plasmids contained 885-bp 5′ homologous arm and 823-bp 3′ homologous arm sequences from the bovineMSTNgene named pbGlrkt and pbFlrkt, and the 1 024-bp 5′ homologous arm and 1 028-bp 3′ homologous arm sequences from the goatCSN2gene named pgGlrkt and pgFlrkt. A schematic of the DSB introduction and subsequent HR and NHEJ (non-homologous end joining) repair can be seen in Fig. 1-A, and the map of donor plasmids is shown in Fig. 1-B and C.

2.3. Culture of bovine fetal fibroblasts and dairy goat fetal fibroblasts

The fetal fibroblasts of Luxi yellow cattle were obtained from the Research Center for Laboratory Animal Science, Inner Mongolia University, China. The dairy goat fetal fibroblasts were obtained from Shanghai Genon Biological Products Co., Ltd., China. Bovine and dairy goat fetal fibroblasts were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1×Pen/Strep solution at 38.5°C and 5% CO2. A passage of two to five cells were used for gene targeting.

2.4. Electroporation of bovine fetal fibroblasts and dairy goat fetal fibroblasts with ZFNs, TALENs, CRlSPR/Cas9 and donor plasmids

Before electroporation of the plasmids into the bovine or goat fetal fibroblasts, the concentration of ZFNs-, TALENs-,CRISPR/Cas9-eGFP, andhFat-1targeting plasmids were adjusted to 1 000 ng μL–1. ZFNs, TALENs, CRISPR/Cas9, eGFP and hFat-1 plasmids were eletroporated into bovine and dairy goat fetal fibroblasts respectively. The electroporation ratio of CRISPR/Cas9 to the targeting plasmids was 1:1, while the ratio of ZFNs and TALENs to the targeting vector was 3:4. When the confluence of bovine fetal fibroblasts and dairy goat fetal fibroblasts reached 70–90%, corresponding to about 1×105/well in a 24-well plate, the cells were dissociated with 0.05% trypsin and washed twice with Opti-MEM to remove the serum from the cells. Subseqently, 9×105fibroblast cells in 90 μL of Opti-MEM were transformed with 10 μL of plasmid in a 2-mm cuvette using a NEPA21 electroporator at 200 V for 2 ms.The two-pulse electroporation was used to transfect the exogenous genes into bovine and dairy goat fetal fibroblasts.After electroporation, the cells were cultured at 38.5°C and 5% CO2. After 2 days, 800 μg mL–1of G418 (Geneticin), an analog of neomycin sulfate, was added to select the cells with successful transfection after 7 days. At this time, the cells formed colonies with apparent borders, in which single colonies can be selected.

2.5. Monoclonal cell line acquisition and culture conditions

The single-cell colonies were obtained by three methods.The first method involved using the cell shove. The colonies with clear borders were marked under the microscope,detached using the cell shove, and transferred to 24-well plates. The second method involved mouth-pipetting to obtain single cells. The cells were dissociated with 0.05% trypsin 48 h post-transfection after 7 days of G418 screening. Single cells were aspired into a glass capillary tube, transferred into 96-well plates, and cultured at 38.5°C,5% CO2for 10 days, changing the medium every 3 days.The third method involved flow cytometry to sort single cells into 96-well plates. Each colony was passaged to 24-well plates, cultured for 5 days, and divided into two parts. One part was frozen in 90% FBS supplemented with 10% DMSO,and the other was used for DNA extraction.

Fig. 1 Schematic of the double-strand break (DSB) introduction and subsequent homologous recombination (HR) and NHEJ (nonhomologous end joining) repair and the donor plasmid maps. A, the diagram of DSB introduction by ZFNs, TALENs and CRISPR/Cas9 systems, followed by HR and NHEJ repair. B, the eGFP gene donor plasmid map. C, the hFat-1 gene donor plasmid map.

2.6. Genomic DNA extraction

To extract the genomic DNA, the cells in 24-well plates were washed with phosphate-buffered saline and lysed in 300 μL of lysis buffer (0.1 mol L–1Tris-HCL, pH 8.0, 0.2 mol L–1NaCl,5×10–3mol L–1EDTA pH 8.0, 0.2% sodium dodecyl sulfate,20 μg mL–1proteinase K) at 38.5°C overnight. Subsequently,300 μL of phenol and chloroform (1:1), 300 μL of chloroform,and 600 μL of isopropanol were added to precipitate DNA, followed by the addition of 70% ethanol to wash the DNA. The DNA was then resuspended in 50–100 μL of sterile water.

2.7. eGFP and hFat-1 knock-in screening

PCR was performed using the Tks Gflex DNA polymerase to amplify and check for the homologous arms of theeGFP/hFat-1knock-in that was introduced to the cells. The genomic DNA PCR primers used to detect the homologous recombination events were located outside the 5′ and 3′ arms.

The PCR primers to detect theeGFP/hFat-1integration at the bovineMSTNlocus were as follows:

LH-LF: ACGGCTCCTTGGAAGACGATG

LH-LR: AATGGAAAGTCCCTATTGGCGTTA

LH-RF: CGATGCCTGCTTGCCGAATA

LH-RR: AGGAAGGTAGAGGGATGAAGATAGTGG

The PCR was carried out for 35 cycles with de naturing at 95°C for 50 s, annealing at 58°C for 50 s, extension at 72°C for 2 min, and a final extension at 72°C for 10 min.

The PCR primers to detect theeGFPandhFat-1integration to the dairy goatCSN2locus were as follows:

LC-LF: TAATGGATTCTAGGTATTATGC

LC-GFPLR: TGGTAATAGCGATGACTAATACG

LC-GFPRF: CGATGCCTGCTTGCCGAATA

LC-FATLR: AATGGAAAGTCCCTATTGGCGTTA

LC-FATRF: ATCGCCTTCTATCGCCTTCTT

LC-RR: GGAAACAACTGAAGTGACTTAGC

The PCR was carried out for 35 cycles with de naturing at 95°C for 50 s, annealing at 58 or 60°C for 50 s, extension at 72°C for 2 min, and a final extension at 72°C for 10 min. PCR products were analyzed by agarose gel electrophoresis.

2.8. Statistical analysis

The Chi-square test was used to determine significance in the knock-in efficiency between ZFNs and CRISPR/Cas9 or TALENs and CRISPR/Cas9. Statistical significance andP-values are shown on the figures where appropriate.P-values ＜0.05 or ＜0.01 were considered statistically significant and extremely statistically significant, respectively.

3. Results

3.1. ZFNs- and CRlSPR/Cas9-introduction efficiencies of eGFP and hFat-1 knock-ins to the bovine MSTN locus

A detailed schematic illustratingeGFP/hFat-1knock-ins in the bovineMSTNcan be visualized in Fig. 2-A. The DSB was produced by ZFNs or CRISPR/Cas9 and after the introduction of the DNA flanked with homologous ends the exogenous DNA carrying theeGFP/hFat-1insert could be integrated into the cutting site. Successful HR events were screened by PCR that amplified the homologous arm sequences. An agarose gel electrophoresis analysis was employed to visualize theeGFPPCR products at the 5′ arm and can be seen in Fig. 2-B.

After G418 and PCR screening, a total of 13 successfuleGFPknock-in cell lines were obtained from 95 colonies that were co-transfected with ZFNs and pbGlrkt, while nohFat-1-integrated cell lines were detected in the 81 colonies that were co-transfected with ZFNs and pbFlrkt. The efficiency of the ZFNs-mediatedeGFPknock-in was 13.68%. These colonies were obtained by mouth pipetting, and eGFP could be detected under the fluorescence microscope (Fig. 2-C).When CRISPR/Cas9 and pbGlrkt were used to co-transfect bovine fetal fibroblasts, 57 eGFP-integrated cell lines were obtained from the 74 colonies that were electroporated. The efficiency of CRISPR/Cas9-mediatedeGFPtransfection was 77.02%. The eGFP could be detected under thefluorescence microscope (Fig. 2-D). When CRISPR/Cas9 and pbFlrkt were used to co-transfect bovine fetalfibroblasts, 64hFat-1-integrated cell lines were obtained from 81 colonies. The CRISPR/Cas9-mediatedhFat-1transfection efficiency was 79.01% (Table 1). TheeGFPgene knock-in efficiency of the CRISPR/Cas9 system was about 5.6 times higher than that of the ZFNs gene editing system. ThehFat-1gene knock-in was only obtained using the CRISPR/Cas9 system. The CRISPR/Cas9 system gave a significantly higher successful insertion rate into target sequences compared to the ZFNs method (P＜0.01).

3.2. TALENs- and CRlSPR/Cas9-introduction effi-ciencies of eGFP and hFat-1 knock-ins to the dairy goat CSN2 locus

A detailed schematic ofeGFP/hFat-1knock-ins in the dairy goatCSN2locus can been visualized in Fig. 3-A. The DSB was produced by TALENs or CRISPR/Cas9, and HR occurred using the modified DNA for integration into the cutting site. Successful HR events were screened by a PCR that amplified the homologous arm sequences. An agarose gel electrophoresis analysis to visualize the PCR products of theeGFP5′ arm can be seen in Fig. 3-B.

Using TALENs-mediated transfection, a total of 18eGFP-integrated cell lines and 11hFat-1-integrated cell lines were obtained from 68 pgGlrkt-transfected cell lines and 34 pgFlrkt-transfected cell lines, respectively, by cell shoving method. The efficiencies of TALENs-mediated knock-ins were 26.47 and 32.35%, respectively. FivehFat-1-integrated knock-in cell lines were obtained from 23 pgFlrkt-transfected cell lines using the flow sorting method, yielding an efficiency of 21.74%. Using CRISPR/Cas9-mediated transfection, a total of 26hFat-1- and 19eGFP-integrated knock-in cell lines were obtained from 35 pgFlrkt-transfected cell lines and 27 pgGlrkt-transfected cell lines, respectively, by cell shoving method. ThehFat-1andeGFPknock-in efficiency using the CRISPR/Cas9 systems was 74.29 and 70.37%, respectively. TenhFat-1-integrated knock-in cell lines were obtained from 17 pgFlrkt-transfected cell lines using the flow sorting method; thehFat-1knockin efficiency using CRISPR/Cas9 was 58.82% (Table 2).The eGFP expression can be seen in Fig. 3-C and D. The CRISPR/Cas9 technology provided significantly higher successful insertion rates into target sequences than the TALENs system (P＜0.01).

4. Discussion

Adding homologous sequences flanking the gene of interest to an insert can achieve precise modification to the target genesviaHR. However, the efficiency of traditional HR is very low, and screening up to 106–108cells is needed to retrieve a clone with the desired genetic modification (Yuet al. 2011). The emergence of new and highly efficient gene-editing techniques, such as ZFNs, TALENs, and CRISPR/Cas9, has made direct gene targeting achievable in any cell type and at any locus. This is especially pertinent to domesticated animal cell-lines, which are historically extremely difficult to modify because of embryonic stem cell shortages. TheeGFPwith CAG promoter and neomycin resistance gene were used as positive screening markers to compare the targeting sufficiency of ZFNs, TALENs, and CRISPR/Cas9 in this study. The two-pulse electroporation step was used to transfect the exogenous genes into bovine and dairy goat fetal fibroblasts. This method was chosen as ZFNs, TALENs, and CRISPR/Cas9 plasmids are very large and the fact that the ZFNs and TALENs systems utilize a pair of plasmids to transfect cells. However, increased plasmid numbers also increased the cell introduction difficulty and reduced the transfection efficiency. Acquiring single-cell colonies was another limitation in this study. Single cells could not survive over 10 passages because the fibroblasts’ability to proliferate was extremely limited. Cell shove,mouth pipetting, and cell sorting retrieval methods were used to obtain single-cell colonies. After 7–10 days of G418 selection, the border of cell colonies still remained unclear.Hence, the shoved cells got mixed with other cells. Only the cells in the center of the colonies were picked to ensure the purity of the cell colony. The mouth pipetting method was easy to operate but extremely time-consuming, and the survival rate was very low. The cell sorting was the optimal retrieval method and highly efficient. However, the flow cytometer was extremely expensive and difficult to operate.

Fig. 2 The enhanced green fluorescent protein gene (eGFP) introduction into bovine fetal fibroblasts mediated by zinc finger nucleases (ZFNs) and clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9. A, schematic illustration of eGFP/hFat-1 knock-in in the bovine myostatin (MSTN) locus. DSB, double-strand break; HR, homologous recombination. B,electrophoretic analysis of PCR products across the 5′ homologous arm of eGFP-targeted cell lines by CRISPR/Cas9. C, the eGFP expression in ZFNs-mediated cells carrying the eGFP insert. D, the eGFP expression in CRISPR/Cas9-mediated cells carrying the eGFP insert.

Table 1 Gene knock-in efficiency of zinc finger nucleases(ZFNs) and clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9

Fig. 3 The enhanced green fluorescent protein gene (eGFP) introduction into dairy goat fetal fibroblasts mediated by transcription activator-like effector nucleases (TALENs) and clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9. A,schematic illustration of the eGFP/hFat-1 knock-in into the dairy goat β-casein (CSN2) locus. DSB, double-strand break; HR,homologous recombination. B, electrophoretic analysis of PCR products across the 5′ homologous arm of the eGFP-targeted cell lines by CRISPR/Cas9. C, the eGFP expression in TALENs-mediated cells with successful eGFP introduction. D, the eGFP expression in CRISPR/Cas9-mediated cells with successful eGFP introduction.

Table 2 Gene knock-in efficiency of transcription activator-like effector nucleases (TALENs) and clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9

The efficiency of ZFNs-mediatedeGFPorhFat-1insertion at the bovineMSTNlocus was 13.68 and 0%, respectively.At the same locus, theeGFPorhFat-1CRISPR/Cas9-mediated transfection rates reached 77.02 and 79.01%,respectively. The differences in successful transfection between these two techniques were extremely significant(P＜0.01). Our results showed that ZFNs-mediated transfection was not as efficient as the CRISPR/Cas9 gene editing system. The efficiency of the TALENs-mediatedeGFPorhFat-1insertion at the dairy goatCSN2locus was 26.47 and 32.35%, respectively. At the same locus, theeGFPorhFat-1CRISPR/Cas9-mediated transfection rates reached 74.29 and 70.37%, respectively. The differences in successful transfection between these two techniques was extremely significant (P＜0.01). Using the cell sorting method to obtain the individualhFat-1-transfected cells, the efficiency of TALENs- and CRISPR/Cas9-mediated gene editing was 21.74 and 58.82%, respectively. Our results also indicated that the CRISPR/Cas9 system was more efficient than the TALENs system in goat gene editing.

The goal of this study was to knock-in thehFat-1gene to the bovineMSTNand dairy goatCSN2loci to increase the levels of ω-3 PUFAs in the muscle tissues and milk product.The ω-3 PUFAs compounds has positive effects on tumor treatments (Kokuraet al. 1997), neurological diseases(Kawakitaet al. 2006), heart disease (Kromhoutet al.1985), diabetes (Storlienet al. 1997), and immune diseases(Puertollanoet al. 2002). Mammals cannot transform ω-6 into ω-3. Hence, ω-3 PUFAs must be supplemented through diet. However, the ω-3 content in food is extremely low. In 2004, Kanget al. (2004) generated aFat-1transgenic mouse model and found that the contents of ω-6 PUFAs decreased and ω-3 PUFAs increased, respectively (Kanget al. 2004).Later, aFat-1transgenic pig (Laiet al. 2006; Panet al. 2010),bovine (Guoet al. 2011; Wuet al. 2012), and sheep (Zhanget al. 2013) were also developed. However, these studies were mostly based on random integration approaches to integrate exogenous DNA into the animal genome and the efficiency to obtain transgenic cells was extremely low. The uncertainty of the integration location, potential to suppress the gene expression, and genetic issues such as sustainability remain questionable (Hanet al. 2015). Although our methods focused on trasfecting single cells with thehFat-1knock-in mutation, we showed that site directed DNA integration was possible with high efficiency using CRISPR/Cas9.Additionally, we showed that incorporating this ω-3 PUFAs encoding gene could be directed not only into various loci but into different livestock cell lines. These results showed that CRISPR/Cas9 has opened a new era of precise gene editing on domesticated animals.

5. Conclusion

In bovine fetal fibrobalsts, using the CRISPR/Cas9-mediated gene knock-in system in theMSTNlocus was more efficient than using the ZFNs-mediated system. In dairy goat fetalfibroblasts, the CRISPR/Cas9-mediated system to introduce gene knock-ins at theCSN2locus was more efficient than using the TALENs-mediated system. The results of this study demonstrate how the efficiency of the CRISPR/Cas9 system could prove to be an indespensable tool for precise gene editing in domesticated animals.

Acknowledgements

This study was supported by the National Transgenic Project of China (2016ZX08010001-002), the National Natural Science Foundation of China (81471001), the Inner Mongolia Science and Technology Program, China (201502073), and the National 863 Prgram of China (2009AA10Z111).

Christian M, Cermak T, Doyle E L, Schmidt C, Zhang F,Hummel A, Bogdanove A J, Voytas D F. 2010. Targeting DNA double-strand breaks with TAL effector nucleases.Genetics, 186, 757–761.

Guo T, Liu X F, Ding X B, Yang F F, Nie Y W, An Y J, Guo H. 2011. Fat-1 transgenic cattle as a model to study the function of omega-3 fatty acids.Lipids in Health and Disease, 10, 244.

Han H B, Wang T, Lian T. 2014. One-step generation of myostatin gene knockout sheepviathe CRISPR/Cas9 system.Frontiers of Agricultural Science and Engineering,1, 2–5.

Han X J, Liang H, Yun T, Zhao Y H, Zhang M L, Zhao L H, Li R F, Li X L. 2015. Decreased expression of humanized Fat-1 in porcine fetal fibroblasts following deletion of PGK-neomycin resistance.Genetics and Molecular Research,14, 11594–11604.

Heo Y T, Quan X, Xu Y N, Baek S, Choi H, Kim N H, Kim J. 2015.CRISPR/Cas9 nuclease-mediated gene knock-in in bovine-induced pluripotent cells.Stem Cells and Development,24, 393–402.

Kang J X, Wang J, Wu L, Kang Z B. 2004. Transgenic mice:Fat-1 mice convert n-6 to n-3 fatty acids.Nature, 427, 504.

Kawakita E, Hashimoto M, Shido O. 2006. Docosahexaenoic acid promotes neurogenesisin vitroandin vivo.Neuroscience,139, 991–997.

Kim Y G, Cha J, Chandrasegaran S. 1996. Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain.Proceedings of the National Academy of Sciences of the United States of America, 93, 1156–1160.

Kokura S, Yoshikawa T, Kaneko T, Iinuma S, Nishimura S, Matsuyama K, Naito Y, Yoshida N, Kondo M. 1997.Efficacy of hyperthermia and polyunsaturated fatty acids on experimental carcinoma.Cancer Research, 57, 2200–2202.

Kromhout D, Bosschieter E B, de Lezenne Coulander C. 1985.The inverse relation between fish consumption and 20-year mortality from coronary heart disease.The New England Journal of Medicine, 312, 1205–1209.

Lai L, Kang J X, Li R, Wang J, Witt W T, Yong H Y, Hao Y, Wax D M, Murphy C N, Rieke A, Samuel M, Linville M L, Korte S W, Evans R W, Starzl T E, Prather R S, Dai Y. 2006.Generation of cloned transgenic pigs rich in omega-3 fatty acids.Nature Biotechnology, 24, 435–436.

Li T, Huang S, Jiang W Z, Wright D, Spalding M H, Weeks D P, Yang B. 2011. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain.Nucleic Acids Research, 39, 359–372.

Liu X, Wang Y, Guo W, Chang B, Liu J, Guo Z, Quan F, Zhang Y. 2013. Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β-casein locus in cloned cows.Nature Communications, 4, 2565.

Liu X, Wang Y, Tian Y, Yu Y, Gao M, Hu G, Su F, Pan S, Luo Y, Guo Z, Quan F, Zhang Y. 2014. Generation of mastitis resistance in cows by targeting human lysozyme gene to beta-casein locus using zinc-finger nucleases.Proceedings of the Royal Society(B), 281, 20133368.

Luo J, Song Z, Yu S, Cui D, Wang B, Ding F, Li S, Dai Y, Li N. 2014. Efficient generation of myostatin (MSTN) biallelic mutations in cattle using zinc finger nucleases.PLOS ONE,9, e95225.

Miller J C, Tan S, Qiao G, Barlow K A, Wang J, Xia D F, Meng X, Paschon D E, Leung E, Hinkley S J, Dulay G P, Hua K L, Ankoudinova I, Cost G J, Urnov F D, Zhang H S, Holmes M C, Zhang L, Gregory P D, Rebar E J. 2011. A TALE nuclease architecture for efficient genome editing.Nature Biotechnology, 29, 143–148.

Moghaddassi S, Eyestone W, Bishop C E. 2014. TALEN-mediated modification of the bovine genome for largescale production of human serum albumin.PLOS ONE,9, e89631.

Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, Polejaeva I A, Chen C. 2014. Efficient gene knockout in goats using CRISPR/Cas9 system.PLOS ONE, 9, e106718.

Pan D, Zhang L, Zhou Y, Feng C, Long C, Liu X, Wan R, Zhang J, Lin A, Dong E, Wang S, Xu H, Chen H. 2010. Efficient production of omega-3 fatty acid desaturase (sFat-1)-transgenic pigs by somatic cell nuclear transfer.Science China(Life Sciences), 53, 517–523.

Proudfoot C, Carlson D F, Huddart R, Long C R, Pryor J H, King T J, Lillico S G, Mileham A J, McLaren D G, Whitelaw C B,Fahrenkrug S C. 2015. Genome edited sheep and cattle.Transgenic Research, 24, 147–153.

Puertollano M A, de Pablo M A, Alvarez de Cienfuegos G.2002. Relevance of dietary lipids as modulators of immune functions in cells infected withListeria monocytogenes.Clinical and Diagnostic Laboratory Immunology, 9, 352–357.

Rouet P, Smih F, Jasin M. 1994. Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells.Proceedings of the National Academy of Sciences of the United States of America, 91, 6064–6068.

Sato M, Miyoshi K, Nagao Y, Nishi Y, Ohtsuka M, Nakamura S, Sakurai T, Watanabe S. 2014. The combinational use of CRISPR/Cas9-based gene editing and targeted toxin technology enables efficient biallelic knockout of the alpha-1,3-galactosyltransferase gene in porcine embryonicfibroblasts.Xenotransplantation, 21, 291–300.

Spychalla J P, Kinney A J, Browse J. 1997. Identification of an animal omega-3 fatty acid desaturase by heterologous expression inArabidopsis.Proceedings of the National Academy of Sciences of the United States of America, 94,1142–1147.

Storlien L H, Kriketos A D, Calvert G D, Baur L A, Jenkins A B.1997. Fatty acids, triglycerides and syndromes of insulin resistance.Prostaglandins,Leukotrienes,and Essential Fatty Acids, 57, 379–385.

Wu H, Wang Y, Zhang Y, Yang M, Lv J, Liu J, Zhang Y. 2015.TALE nickase-mediated SP110 knockin endows cattle with increased resistance to tuberculosis.Proceedings of the National Academy of Sciences of the United States of America, 112, E1530–E1539.

Wu X, Ouyang H, Duan B, Pang D, Zhang L, Yuan T, Xue L, Ni D, Cheng L, Dong S, Wei Z, Li L, Yu M, Sun Q Y, Chen D Y,Lai L, Dai Y, Li G P. 2012. Production of cloned transgenic cow expressing omega-3 fatty acids.Transgenic Research,21, 537–543.

Yu S, Luo J, Song Z, Ding F, Dai Y, Li N. 2011. Highly efficient modification of beta-lactoglobulin (BLG) geneviazinc-finger nucleases in cattle.Cell Research, 21, 1638–1640.

Zhang P, Liu P, Dou H, Chen L, Chen L, Lin L, Tan P, Vajta G,Gao J, Du Y, Ma R Z. 2013. Handmade cloned transgenic sheep rich in omega-3 fatty acids.PLOS ONE, 8, e55941.

Zhao Y, Liang H, Liu M, Li X. 2014. The application of gene knock-out technologies in big domestic animals.Acta Veterinaria et Zootechnica Sinica, 45, 1–8.

Zhou X, Xin J, Fan N, Zou Q, Huang J, Ouyang Z, Zhao Y, Zhao B, Liu Z, Lai S, Yi X, Guo L, Esteban M A, Zeng Y, Yang H,Lai L. 2015. Generation of CRISPR/Cas9-mediated genetargeted pigsviasomatic cell nuclear transfer.Cellular and Molecular Life Sciences, 72, 1175–1184.