Expression Pattern of phb2 and Its Potential Function in Spermatogenesis of Scallop (Chlamys farreri)

HAN Tiantian, MA Xiaoshi, LIANG Shaoshuai, GAO Beibei, and ZHANG Zhifeng

?

Expression Pattern ofand Its Potential Function in Spermatogenesis of Scallop ()

HAN Tiantian, MA Xiaoshi, LIANG Shaoshuai, GAO Beibei, and ZHANG Zhifeng*

,,,266003,

Prohibitin (PHB) participates in several biological processes including apoptosis, transcription regulation and suppression of cell proliferation in mammals. In this study, we cloned the full-length cDNA of() from the testis of scallop ().The deduced amino acid sequence presented a characteristic of PHB family with the PHB domain, and clustered with PHB2 of other species. Temporal and spatial expression ofhybridization. The expression ofwas the highest at mature stage, which was about 15-fold higher than that at proliferative stage. The expression ofcould be detected byhybridization in all types of germ cells in testis, including spermatogonia, spermatocytes, spermatids and spermatozoa. The intensity of the signal increased with the spermatogenesis and was the highest in spermatids, which suggested that CF-PHB2 might affect the spermatogenesis of.

; spermatogenesis; testis;

1 Introduction

Prohibitin (PHB) belongs to Band-7 super family and is characterized by the PHB domain or the SPFH domain (Chowdhury., 2012; Merkwirth and Langer, 2009; Mishra., 2006). It consists of two highly homologous members termed prohibitin 1 (PHB1) and prohibitin 2 (PHB2) (Mishra., 2006). McClung(1989) cloned the firstcDNA from ratliver cells, and foundmRNA blocked DNA synthesis in human fibroblasts. The similar phenomenon was observed in HeLa cells (Nuell., 1991) and chronic lymphocytic leukemia B cells (Woodlock., 2001). In addition, mutation of PHB1 was detected in human breast tumor cells (Sato., 1992), and deletion of PHB1 was detected in human ovarian tumor cells (Foulkes., 1993), suggesting that PHB1 plays a role in suppressing tumors. Dixit. (2003) reported that the majority of the proliferating thymocytes in rat thymus failed to express PHB1 protein, but nonproliferating thymocytes expressed it at a high level. Aurilide, a potent cytotoxic marine natural product that induces apoptosis in cultured human cells, can selectively bind to PHB1 in mitochondria, and activate the proteolytic processing of OPA1, resulting in mitochondria-induced apoptosis (Sato., 2011). Many researches showed that PHB1 inhibits the transcriptional activity of E2F by binding to E2F (Fusaro., 2003; Joshi., 2003; Wang., 1999a; Wang., 1999b). Choi. (2008) further proved that PHB1 combines directly with E2F1, a kind of multisubunit transcription factor, to repress the transcription activity of E2F1.

ThecDNA was first cloned from mouse () B cells (Terashima., 1994). PHB2 is named as a repressor of estrogen receptor activity (REA) because it represses the transcription activity of estrogen receptor (ER) by competing for activator binding sites on ER in the nucleus of human breast cancer cells (Montano., 1999). Park. (2005) deleted the REA gene () in the mouse and revealed that the REA restrains estrogen actions by moderating ER stimulation and enhancing ER repression of E2-regulated genes. In yeast and mammalian cells, PHB2 can inhibit muscle differentiation by repressing the transcription activity of both MyoD and MEF2, and specifically recruit HDAC1 which is important for its repressive activity (Sun., 2004).

Data ofgene in spermatogenesis are limited. Recently, Mao(2012) suggested thatmay fulfill critical functions in spermatiddifferentiation of Chinese mitten crab () byhybridization. Fang. (2013) found that PHB which was finally clustered into PHB1 subfamily plays a role in spermatogenesis in crayfish (. In this study, we isolated the full-length cDNA of() in scallop (), and revealed its expression characteristic in testis in the reproductive cycle with real-time PCR andhybridization techniques. Our aims were to establish an expression pattern of

2 Materials and Methods

2.1 Animals and Sampling

Healthy scallops (with a mean shell height of 6.38±0.33cm were purchased from NanShan Aquatic Product Market (Qingdao, China). Six scallops at each developmental stage of testis were employed in this study. The testes were dissected and weighed rapidly. Part of testes was immersed in liquid nitrogen immediately, and then stored at ?80℃ for total RNA extraction. Part of testes was fixed with 4% paraformadehyde in 0.1molL?1phosphate buffer (pH7.4) at 4℃ for 16h, and then dehydrated with 25, 50, 75 and 100% methanol. Finally they were stored in 100% methanol at ?20℃ forhybridization. Some middle parts of the testes were fixed in Bouin’s solution for 24h, and then dehydrated with an ascending gradient of ethanol (30%, 50%, 70%, 80%, 95%, 100%). Finally they were embedded in paraffin wax,sliced in a thickness of 6μm, and stained by haematoxylin-eosin (H & E). The histology of testis at different developmental stages was observed and photographed under a Nikon E80i microscope.

Following the morphologic features described by Liao. (1983), the testis development of the scallop was divided into four stages according to the histological structure (Fig.1). Gonadosomatic index (GSI=gonad weight/soft tissue body weight×100) was 2.46±0.009 at resting stage, 3.89±0.008 at proliferative stage, 3.93±0.012 at growing stage, and 4.53±0.009 at mature stage, respectively.

2.2 RNA Isolation, Reverse Transcription, 3’ and 5’ RACE

Total RNA was extracted from the stored testes (about 200mg) at each stage using acid phenol-guandine thiocyanate-trichloromethane extraction method according to the described in Molecular Cloning: A Laboratory Manual (Sambrook and Russell, 2001). The RNA quality was estimated by agarose gel electrophoresis, and its concentration and purity was assayed by spectrophotometry at 260nm and 280nm. First-strand cDNA was synthesized using PrimeScriptTMRT reagent Kit (Takara, Dalian, China).

The cDNAs were amplified with 3’ and 5’ RACE (rapid amplification of cDNA ends) strategy by usingSMARTerTMRACE cDNA Amplification Kit (Takara, Dalian, China), and the specific primers RACE-3’ (5’- CCAAGGTTTGCGGGTCAACAAGAAGGAC-3’) and RACE-5’ (5’-CTTCCACTTAACCCTTTCACCCCCATG- 3’) designed according to a 368bp sequence obtained fromtranscriptome database. The 3’ RACE was conducted by initially denaturing at 94℃ for 5min followed by 35 cycles of denaturing at 94℃ for 30s, annealing at 68℃ for 30s and extending at 72℃ for 2min; and 5’ RACE was carried out by initially denaturing at 94℃ for 5min followed by 35 cycles of denaturing at 94℃ for 30 s, annealing at 65℃ for 30s and extending at 72℃ for 2min.

2.3 Bioinformatic Analysis

The 5’ and 3’ RACE fragments were assembled by the software of DNAstar to obtain the full-length of cDNA sequence. The similarity ofPHB2 was compared with other known PHB2 amino acid sequences using the programs ofInterPro database and BLAST at the NCBI. The multiple sequence alignments were performed with LCUSTAL X and GeneDoc softwares. A phylogenetic tree was constructed using MEGA 4.0 software with Neighbor-Joining method.

2.4 Quantitative Analysis with Real-Time PCR

The expression ofSYBRRPremix Ex TaqTM(Tli RNaseH Plus) (Takara, Dalian, China) and ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with the specific primers phb2-S (TCGGATAAGTGGGGTACAGC), phb2-A (CTTGGCC TGGCTCTAATGTC) for amplification of a 102bpfragment, and primers actin-S (5’-TTCTTGGGA ATGGAATCTGCCG-3’), actin-A (5’-CCTGGGAACAT TGTGCTACC-3’) for a 131bp fragmentof(AY335441) as reference following Zhou. (2011). Annealing temperature of the two pairs of primers was 60℃. The real-time PCR reaction was conducted for 40 cycles of 95℃ 5min, 94℃ 15s, annealing and elongating at 60℃ for 1min. Testis RNA from six individuals at the same stage was detected twice each. Data were analyzed using ABI 7500 system SDS software version 1.4 (Applied Biosystem) with automatically set baseline and cycle threshold values (Zhou., 2010). The 2?ΔΔCtmethod was used to analyze the mRNA expression of.

All data were indicated as mean ± S.E. (=6). Differences were tested using one-way analysis of variance followed by the least significant difference tests (SPSS software version 12.0; SPSS Inc., Chicago, IL, USA) with a significance level set at0.05.

2.5Hybridization

A 539bp fragment ofwas amplified using a pair of specific primers, Ins-S (5’-CGCGAATTCTGA AATCAATGAAAGCTG-3’) and Ins-A (5’ GTCAAGCT TACTGTATAGATGACCTTGT 3’). Digoxigenin (DIG)- labeled RNA sense and antisense probes were synthesized using a DIG RNA Labeling Kit (SP6/T7) (Roche, Mannheim, Germany) with the amplified fragment as template. Samples stored in methanol at ?20℃ were dehydrated in an ascending gradient of ethanol, and then cleared in xylene and embedded in paraffin wax. Sections were cut in 5μm, and stuck on microscope slides with 0.1% poly- lysine. Thehybridization procedure was conducted as described by Feng(2011), but digested with 2μgmL?1protease Kfor 10min at 37℃ and counterstain with 1% neutral red. The sections were observed and photographed with a Nikon E80i microscope.

3 Results

3.1 Sequence and Characterization of the Target cDNA

Two fragments of 1331bp and 1238bp were obtained from 5’ and 3’ RACE, and the full-length cDNA sequence was assembled, which was 2122bp (KF601690), and contained an 882bp open reading frame (ORF) that encoded a deduced protein of 293 amino acids, beginning with a methionine codon at position 58 and ending with a TAG stop codon at position 937, also consisted of a 57bp 5’ untranslated region (5’UTR) and a 1183bp 3’UTR which contained five polyadenylation signals (AATAAA) and a poly (A) tail of 30bp.

Multiple sequence alignment analysis indicated that the deduced amino acid sequence contained three domains of PHB family including a well-conserved PHB domain, an N-terminal hydrophobic transmembrane domain, and a C-terminal coiled-coil domain (Fig.2a). Moreover, the deduced amino acid sequence shared a high similarity with other known PHB2 including those of(78%),.(78%),.(77%),.(77%),.(77%),.(75%),.(74%),.(73%),.(69%). Furthermore, the constructed phylogenetic tree presented two distinct branches of PHB1 and PHB2, and thetarget sequence was clustered to PHB2 subfamily (Fig.2b). The result illustrated that the evolutionary status of the() is consistent with the traditional taxonomy of species.

3.2 Expression Pattern of

The real-time PCR result indicated that theexpressed intestis at every developmental stage in reproductive cycle, and the expression level increased with the testis development (Fig.3). Comparatively, the expression level in the testis of the mature stage was the highest, about 15-folds of the proliferative stage, and about 3-folds of the growing stage. Byhybridization, the positive signals were observed in all the testis cells of. However, the hybridization signal intensity ofwas different (Fig.4) and changed with the development of germ cells, which was generally lower in the spermatogonia than in other types of germcells, except the spermatozoa. The signal was stronger in the secondary spermatocytes than that in the primary spermatocytes, and strongest in spermatids. Furthermore, there was no visible signal in some spermatogonia of testis at proliferative stage, growing stage and mature stage.

Fig.2 Sequence comparison of PHB among different species. a, Multiple sequence alignment. The transmembrane domain is double-underlined, and the PHB domain is single-underlined. The coiled-coil domain is dotted-underlined. The consistency residues in non-vertebrates are shown in black boxes. b, Phylogenetic relationship of PHB. The reliability of the branching is tested by bootstrap re-sampling (with 1000 pseudo replicates). The scale bar indicates evolutionary distance of 0.1 amino acid substitutions per site.

Fig.3 Expression of Cf-phb2 inC. farreri testis. The expression in growing testis is set as 1.00 to calibrate the relative level at different stages. Values are expressed as mean±S.E. (n=6). The different letters indicate significant difference (P<0.05).

Fig.4 Location of Cf-phb2 mRNA in C. farreri testes. a, resting stage; b, proliferative stage; c, growing stage; d, mature stage; Positive signals with an antisense probe are shown in blue or dark blue (a1–d1); a2–d2, magnification from the box in a1–d1, respectively; a3–d3, negative controls with a sense probe; Fc, follicle cell; Sg, spermatogonium; pSc, primary spermatocyte; sSc, secondary spermatocyte; St, spermatid; Sz, spermatozoon. Scale bar=30μm.

4 Discussion

In this study, the full length cDNAoffrom the scallopwas cloned, which contained theconservedPHB domain, N-terminal hydrophobic transmembrane domain and C-terminal coiled-coil domain.Furthermore,we demonstratedthe expression pattern ofmRNA in testis in reproductive cycle, and suggestedthatthemay take part in the development of male germ cells.

4.1 Structure Analysis of the-PHB2

Up to now, it is well known the members of PHB family should include three domains, including PHB domain, transmembrane domain and coiled-coil domain. The amino acid sequence of the PHB domain, which is similar in both eukaryotic and prokaryotic PHB proteins, is the most evolutionarily conservative domain (Tavernarakis., 1999), and might associate with a lipid or a lipid domain (Morrow and Parton, 2005). The N-terminal hydrophobic transmembrane domain is thought to involve in anchoring PHBs to the mitochondrial inner membrane in various organisms (Berger and Yaffe, 1998; Coates., 1997; Ikonen., 1995; Sanz., 2003). The coiled- coil domain is proved to be crucial for the assembly of PHB complexes in yeast (Tatsuta., 2005). The sequence conservatism of the N-terminal hydrophobic transmembrane domain seems to be lower than that of the coiled-coil domain (Tatsuta., 2005), and is capable of repressing E2F1-mediated transcription (Joshi., 2003). In this study, the deduced amino acid sequence of the full-length cDNA contained the three domains and shared a similar sequence characteristic mentioned above, and clustered to the PHB2. Therefore, the cloned cDNA sequence should be, thus was named as-. Furthermore, we found several residues locating in the PHB domain and the coiled-coil region (marked by black boxes in Fig.2a) were only shared by non-verte- brates. These residues may be the characteristics of invertebrate PHB2.

4.2Plays a Role in Spermatogenesis

To our knowledge, only two studies have been reported about the effect of PHB on spermatogenesis (Fang., 2013; Mao., 2012) divided the spermatid development of Chinese mitten crabinto three stages including early, middle and late stages. Byhybridization analysis, it was found themRNA localized in different regions of spermatid at three different stages, presuming thatmay fulfill critical functions in the spermitogenesis of. Fang(2013)found the expression of the crayfish(-) gene increased gradually in the testis from absence phase to developmental and multiplication phases during the testis development, while decreased from mature phase to resting phase. The similarPHB expression level was examined by western blot, suggesting that the-PHB is an essential protein in the crayfish spermatogenesis. Comparing the result with that in crayfish, the expression pattern of-, implying a similar function of the-andduring the spermatogenesis. However, in the mature testis, the expression of-andis different.In scallop,mRNA level reached the highest in the mature testis (Fig.3), while the expression ofis downregulated and is lower in the mature testis than that in the multiplication phase in crayfish. We speculated that the expression difference in mature testis between the two species may be caused by different members of PHB. In scallop, it is,while in crayfish it should be. This speculation is based on the fact that-PHB is finally clustered into PHB1 subfamily in the phylogenetic tree (Fang., 2013). It is possible thatandplay different roles in mature testis, andmay participate in testis mature and sperm release in the scallop.

PHBs are powerful negative regulators of cell proliferation (Merkwirth and Langer, 2009). McClung(1989) found thatcan inhibit cellular proliferation of normal human diploid fibroblasts. The similar phenomenon was observed inHeLa cells (Nuell., 1991) and chronic lymphocytic leukemia B cells (Woodlock., 2001). In some human breast and ovarian cancer, the PHB is found inmutations or deletions, indicating that PHB suppresses tumors through its anti-proliferation function involving cell cycle control (Foulkes., 1993; Leggett., 1995; Sato., 1992). It is well-known that during spermatogenesis, spermatogonia in testis proliferate by mitosis to produce more spermatogonia, and then some of the cells stop the mitosis and move gradually toward the lumen of the follicle and differentiate into primary spermatocytes. The process occurs in proliferative, growing and mature testis of the(Liao., 1983). In this study, we found that themRNA level in spermatogonia was generally lower than that in other types of germ cells, except the spermatozoa. In addition, the visibility ofexpression detected byhybridization was different in spermatogonia of the testis even in the same histological section. It was invisible in some of spermatogonia while was visible in other spermatogonia (Fig.4). Therefore, CF-PHB2 may participate in the mitosis suppression during the spermatogenesis.

Acknowledgements

This work was supported by the National High Technology Research and Development Program of China (863 Program) (2012AA10A402), and the Natural Science Foundation of Qingdao (11-2-4-1(10)-jch).

Berger, K. H., and Yaffe, M. P., 1998. Prohibitin family members interact genetically with mitochondrial inheritance components in., 18: 4043-4052.

Choi, D., Lee, S., Hong, S., Kim, I., and Kang, S., 2008. Prohibitin interacts with RNF2 and regulates E2F1 functiondual pathways., 27: 1716-1725.

Chowdhury, I., Garcia-Barrio, M., Harp, D., Thomas, K., Matthews, R., and Thompson, W. E., 2012. The emerging roles of prohibitins in folliculogenesis., 4: 690.

Coates, P., Jamieson, D., Smart, K., Prescott, A., and Hall, P., 1997. The prohibitin family of mitochondrial proteins re- gulate replicative lifespan., 7: 607-610.

Dixit, V. D., Sridaran, R., Edmonsond, M. A., Taub, D., and Thompson, W. E., 2003. Gonadotropin-releasing hormone attenuates pregnancy-associated thymic involution and mo- dulates the expression of antiproliferative gene product prohibitin., 144: 1496-1505.

Fang, D. A., Wang, Y., Wang, J., Liu, L. H., and Wang, Q., 2013. Characterization ofprohibitin and its potential role in spermatogenesis., 519: 318-325.

Feng, Z. F., Zhang, Z. F., Shao, M. Y., and Zhu, W., 2011. Developmental expression pattern of the Fc-vasa-like gene, gonadogenesis and development of germ cell in Chinese shrimp,., 314: 202- 209.

Foulkes, W. D., Black, D. M., Solomon, E., Trowsdale, J., and Stamp, G. W., 1993. Very frequent loss of heterozygosity throughout chromosome 17 in sporadic ovarian carcinoma., 54: 220-225.

Fusaro, G., Dasgupta, P., Rastogi, S., Joshi, B., and Chellappan, S., 2003. Prohibitin induces the transcriptional activity of p53 and is exported from the nucleus upon apoptotic signaling., 278: 47853-47861.

Ikonen, E., Fiedler, K., Parton, R. G., and Simons, K., 1995. Prohibitin, an antiproliferative protein, is localized to mito- chondria., 358: 273-277.

Joshi, B., Ko, D., Ordonez-Ercan, D., and Chellappan, S. P., 2003. A putative coiled-coil domain of prohibitin is sufficient to repress E2F1-mediated transcription and induce apoptosis., 312: 459-466.

Leggett, B., Young, J., Buttenshaw, R., Thomas, L., Young, B., Chenevix-Trench, G., Searle, J., and Ward, M., 1995. Colo- rectal carcinomas show frequent allelic loss on the long arm of chromosome 17 with evidence for a specific target region., 71: 1070.

Liao, C. Y., Xu, Y. F., and Wang, Y. L., 1983. Reproductive cycles of scallop(Jones and Preston 1904) at Qingdao., 1: 1-13 (in Chinese).

Mao, H., Wang, D. H., Zhou, H., and Yang, W. X., 2012. Characterization and expression analysis of prohibitin in the testis of Chinese mitten crab., 39: 7031-7039.

McClung, J. K., Danner, D. B., Stewart, D. A., Smith, J. R., Schneider, E. L., Lumpkin, C. K., Dell’Orco, R. T., and Nuell, M. J., 1989. Isolation of a cDNA that hybrid selects anti- proliferative mRNA from rat liver., 164: 1316-1322.

Merkwirth, C., and Langer, T., 2009. Prohibitin function within mitochondria: Essential roles for cell proliferation and cristae morphogenesis., 1793: 27-32.

Mishra, S., Murphy, L. C., and Murphy, L. J., 2006. The prohibitins: Emerging roles in diverse functions., 10: 353-363.

Montano, M. M., Ekena, K., Delage-Mourroux, R., Chang, W., Martini, P., and Katzenellenbogen, B. S., 1999. An estrogen receptor-selective coregulator that potentiates the effective- ness of antiestrogens and represses the activity of estrogens., 96: 6947- 6952.

Morrow, I. C., and Parton, R. G., 2005. Flotillins and the PHB domain protein family: Rafts, worms and anaesthetics., 6: 725-740.

Nuell, M., Stewart, D., Walker, L., Friedman, V., Wood, C., Owens, G., Smith, J., Schneider, E., Dell’Orco, R., and Lumpkin, C., 1991. Prohibitin, an evolutionarily conserved intracellular protein that blocks DNA synthesis in normal fibroblasts and HeLa cells., 11: 1372-1381.

Park, S.-E., Xu, J., Frolova, A., Liao, L., O’Malley, B. W., and Katzenellenbogen, B. S., 2005. Genetic deletion of the repressor of estrogen receptor activity (REA) enhances the response to estrogen in target tissues., 25: 1989-1999.

Sambrook, J., and Russell, D. W., 2001.. 3rd edition. Cold Spring Harbor Labo- ratory Press, New York, 518-522.

Sanz, M. A., Tsang, W. Y., Willems, E. M., Grivell, L. A., Lemire, B. D., van der Spek, H., and Nijtmans, L. G., 2003. The mitochondrial prohibitin complex is essential for embryonic viability and germline function in., 278: 32091-32099.

Sato, S.-I., Murata, A., Orihara, T., Shirakawa, T., Suenaga, K., Kigoshi, H., and Uesugi, M., 2011. Marine natural product aurilide activates the OPA1-mediated apoptosis by binding to prohibitin., 18: 131-139.

Sato, T., Saito, H., Swensen, J., Olifant, A., Wood, C., Danner, D., Sakamoto, T., Takita, K., Kasumi, F., and Miki, Y., 1992. The human prohibitin gene located on chromosome 17q21 is mutated in sporadic breast cancer., 52: 1643-1646.

Sun, L., Liu, L., Yang, X. J., and Wu, Z., 2004. Akt binds prohibitin 2 and relieves its repression of MyoD and muscle differentiation., 117: 3021-3029.

Tatsuta, T., Model, K., and Langer, T., 2005. Formation of membrane-bound ring complexes by prohibitins in mito- chondria., 16: 248-259.

Tavernarakis, N., Driscoll, M., and Kyrpides, N. C., 1999. The SPFH domain: Implicated in regulating targeted protein turnover in stomatins and other membrane-associated proteins., 24: 425-427.

Terashima, M., Kim, K.-M., Adachi, T., Nielsen, P., Reth, M., K?hler, G., and Lamers, M., 1994. The IgM antigen receptor of B lymphocytes is associated with prohibitin and a pro- hibitin-related protein., 13: 3782.

Wang, S., Nath, N., Adlam, M., and Chellappan, S., 1999a. Prohibitin, a potential tumor suppressor, interacts with RB and regulates E2F function., 18: 3501-3510.

Wang, S., Nath, N., Fusaro, G., and Chellappan, S., 1999b. Rb and prohibitin target distinct regions of E2F1 for repression and respond to different upstream signals., 19: 7447-7460.

Woodlock, T. J., Bethlendy, G., and Segel, G. B., 2001. Prohibitin expression is increased in phorbol ester-treated chronic leukemic B-lymphocytes., 27: 27-34.

Zhou, Q., Shao, M., Qin, Z., Kyoung, H. K., and Zhang, Z., 2010. Cloning, characterization, and expression analysis of the DEAD-box family genes, Fc-vasa and Fc-PL10a, in Chinese shrimp ()., 28: 37-45.

Zhou, Z., Yang, J., Wang, L., Zhang, H., Gao, Y., Shi, X., Wang, M., Kong, P., Qiu, L., and Song, L., 2011. A dopa decar- boxylase modulating the immune response of scallop., 6: p. e18596.

(Edited by Qiu Yantao)

DOI 10.1007/s11802-015-2593-1

ISSN 1672-5182, 2015 14 (6): 1034-1040

? Ocean University of China, Science Press and Spring-Verlag Berlin Heidelberg 2015

(February 9, 2014; revised March 31, 2014; accepted June 5, 2015)

* Corresponding author.Tel: 0086-532-82031647 E-mail: zzfp107@ouc.edu.cn