Expression of CD44，CD133，and ABCG2 as Potential Cancer Biomarker Proteins

YAN Jin-fei， HOLSBEEKS Inge， SUN Qi-hong

(1.Industrial Sciences，Biochemistry，GroepT，Campus Vesalius，Leuven 3000，Belgi?; 2.Shenyang Pharmcital University，Shenyang 110016，China; 3.Beijing(National)Proteome Research Center，Beijing 100226，China)

A biomarker is a characteristic molecule used as an indicator of a biologic state.Biomarkers are regarded as the important signposts of the physiological state of a cell［1］.The rapid advances in genomics and mass spectroscopic technology in the past ten years have generated a new research field，proteomics.Proteomics is a systematic research approach for studying the proteins expressed by a cell，tissue or organ.Nowadays，proteomics has become a revolutionary tool in biomarker discovery. Disease relates to changes in the protein expression level，would give a basis for detection of biomarkers by measuring the protein expression using proteomics.

Biomarkers can be used to measure a specific physiological or pathological state of an organism. They can be chemical，physical or biological.In our case，biomarkers are molecular indicators which can be used to measure the progress of disease to provide an early guide for possible therapeutics.The application of biomarkers in the evaluation of disease risk has increased significantly in the past ten years.

A key challenge in cancer control and preven-tion is to detect disease as early as possible. Biomarkers are detectable end points that reveal events in the processes which lead to severe disease.As a normal cell transforms to a cancerous state，biomarkers prove to be very important for the identification of early cancer［2］.Cancer biomarkers can be generated by the tumor itself or by the body while responding to the tumor.There are six different types of cancer biomarkers.(1)Biomarkers for early detection:the biomarkers are used to screen cancer patients to detect cancer at an early stage. (2)Biomarkers for diagnose:biomarkers can aid to identify histopathology characteristics in evaluating the presence or absence of cancer.(3)Prognostic: biomarkers are used for dissection of the outcome of patients into distinct prognostic risk groups，thus allowing individualized treatment.It can forecast the course of the disease.It helps us understand tumor behavior，thus identifying aggressive phenotype. (4)Predictive:biomarkers are used to foretell whether therapeutics will be effective.(5)Therapeutic target:biomarkers can aid to identify patients who will benefit from therapeutic regimen.(6)Surrogate end point:biomarkers are used to replace a clinical end point or to determine clinical benefit.

Stem cells are defined by their capacity to both self-renew and generate multiple lineages.Almost all adult tissues are known to possess tissuespecific stem cells that serve to replace worn out tissues.In spite of tissue origin，stem cells have the underlying function of keeping tissue homeostasis. The cancer stem cell is defined as a cancer cell that has the capacity to self-renew，dividing to generate another malignant stem cell and a cell that generates tumor cell populations that are very diverse phenotypically［3］.While there are many similarities between cancer and normal stem cells，there are also differences between them.Normal stem cells only represent a very small population of cells in the tissue where they reside，while putative cancer stem cells make a rather significant portion of tumor cells［4］.According to the cancer stem cell hypothesis，cancer is initiated and driven by abnormal stem cells derived from normal stem cells.Therefore，like the normal stem cells，these tumor-initiating stem cells possess self-renewal properties and have the ability to produce progenitor stem cells.

Cancer stem cells have been proved to be critical in the progression of cancer.Some important markers of cancer stem cells have been characterized in many leukaemias and solid tumors.CD133 (also known as Prominin-1 or AC133)is a fivetransmembrane domains which was initially regarded as a specific human hematopoietic stem cell surface antigen［5］and as a marker for mouse neuroepithelial cells and some embryonic epithelia［6］. Subsequently，researchers found its expression on endothelial，lymph-angiogenic and myo-angiogenic progenitors.Whereas the function of CD133 is unknown，CD133 is regarded as a marker for normal stem cells and cancer stem cells.Now，people used CD133 alone or in combination with other markers to isolate stem cells from numerous tissues，such as bone marrow，brain，prostate，kidney，liver and pancreas［7］.Recently，many studies reported that monoclonal antibodies against CD133 had been used to isolate a putative cancer stem cell population from tumors of brain，lung，prostate，pancreas，liver，and colon［8］.

CD44 is expressed on many types of cells and interacts with some different extracellular matrix components［9］.It is a cell-surface typeⅠ transmembrane glycoprotein related with cell-cell interactions，cell adhesion and migration.CD44 functions as a“bone homing receptor”，directing movement of human hematopoietic stem cells and mesenchymal stem cells to bone marrow.CD44 has been involved in many normal and disease processes，including for example tumor migration.Previous researches demonstrate that CD44 is a potential stem cell marker for normal prostatic epithelium or prostate cancer［10］.Moreover，the CD44 molecule has also been recognized as a cancer stem cell marker in some other different tumors.

ATP-binding cassette proteins exist in all known living species.It has a relatively conserved structure containing both conserved ABC and transmembrane domains.In mammals，the ATP-binding cassette proteins are composed of four domains，two ATP-binding cassette domains and two transmembrane domains.ATP-binding cassette superfamily G member 2(ABCG2)is a member of the ATP binding cassette family.It was initially discovered for its capacity to confer drug resistance in tumor cells. ABCG2 appears to possess an important function in stem cell protection and regulation.The expression of ABCG2 is induced by low oxygen conditions，which is in agreement with its high level expression in tissues placed in low oxygen environments［11］. Previous studies have indicated that ABCG2 expresses highly in primitive stem cells.The high expression of ABCG2 has been suggested to identify cancer stem cells［12］.

Antibodies are naturally occurring proteins produced by the human B lymphocytes.They are generated in response to antigens that are recognized as foreign substances to the body.When an antigen enters the body，the human immune system responds by producing antibodies which can react with this antigen.Actually，a large antigen can bind to many antibodies against its different antigenic epitopes.The heterogeneity of the immune response plays a critical role in the body’s natural defense mechanism.As we all know，the hybridoma technology was introduced by Kohler and Milstein in 1975［13］.This innovative technology can be employed to construct the cell line which produces monoclonal antibody with predetermined reactivity. The resulting hybrid cell(denoted as hybridoma)is cultured by using selective medium which does not allow the proliferation of either parent cells.Ever since 1975，considerable monoclonalantibodies have been prepared for basic research and clinical application.In diagnostic aspect，monoclonal antibodies can be selected to prepare specific diagnostic reagents.In therapeutic applications，monoclonal antibodies with distinct specificities can be used to treat different disorders.Nowadays，monoclonal antibodies have been used widely in research and therapeutics.

The rapid development of cancer biomarker research in the past ten years is attributed to a large extent to the invention of the monoclonal antibody technology.Up to now，monoclonal antibodies have been generated against various human tumors，such as melanoma，leukemia，neuroblastoma，colorectal carcinoma，mammary carcinoma，lung cancer，ovary carcinoma，lymphoma，renal cancer and so on.Monoclonal antibodies specific for cancer markers have important clinical use in diagnosis and therapeutics.

In this study，the CD44，CD133 and ABCG2 antigen were analyzed for their respective antigenic epitopes by Genestar.After analysis，the gene encoding protein fragment with sound immunogenicity was cloned by PCR and inserted to the multiple cloning site of the pGEX-4T-1 or pET32a plasmid. The resulting expression vector was transformed into the E.coli BL21 strain and the protein expression was induced by the addition of IPTG.Finally，the target protein was characterized by the SDS-PAGE and Western Blot analysis.In further study，these CD44，CD133 and ABCG2 target protein fragments will be used for development of specific monoclonal antibodies，which can be employed to identify cancer stem cells.

1 Materials and Methods

Strains and Vectors——E.coli.DH5α and BL21(DE3)bacteria were used as the cloning and expression host cells，respectively.The corresponding competent strains were prepared according to the standard procedure of our lab.Fusion expression vectors pET-32a(Fig.1)and pGEX-4T-1 (Fig.2)were purchased from Amersham.

Fig.1 The pET-32a vectors

Fig.2 The pGEX-4T-1 vectors

The Biochemical and Bio-molecular reagents—The restriction enzymes，T4 DNA ligase and ExTaq DNA ploymerase were purchased from Takara(Japan).The gel extraction kit was purchased from Omega.The plasmid mini kit was purchased from Promega. Isopropyl-β-D-thiogalactoside (IPTG)was purchased from Amersham.Cell culture reagents(peptone，yeast extract and sodium chloride)were purchased from OXOID(England). The MicroBCA protein assay kit was purchased from Pierce(Rockford，IL).All of other chemical reagents were of analytical grade.

Major instruments——PCR amplifier was bought from Biometra.Horizontal electrophoresis system and Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell was obtained from Bio-Rad Amersham.5819R Cryogenic Centrifuge Equipment was obtained from Eppendorf.JY92-11 Ultrasonic Cracker was obtained from Ningbo Xinzhi Biotech Co.，Ltd.680 Microplate Spectrophotometer and UV spectrometer were obtained from Bio-Rad.

DNA synthesis and sequencing——The sequencing of inserted exogenous gene was carried out by Beijing Aoke Biotech Co.To analyze if there is any mutation in the obtained sequence，the obtained sequence was compared with the amino acid sequence derived from Genbank.

Based upon the genes of three proteins donated by partner lab，we has designed three pairs of primers，which can be used to amplify the DNA fragment of about 579～639 bp in the three cancer stem cell marker gene，CD133，CD44 and ABCG2.

Competent cell preparation——The competent cell was prepared by a standard calcium chloride method as described below.Briefly，DH5α and BL21 bacteria liquor was inoculated in 30 mL LB culture medium，which was activated overnight at the proportion of 1∶100.The activation procedure was performed under intense oscillation at 250 r/ min at 37℃.When the OD600 of the bacteria liquor reached at 0.3～0.4，the bacteria liquor was transferred to a pre-cooled 50 mL centrifugal tube，and kept for ice bath for 10 min.The bacteria liquor was centrifuged at 4 100 r/min at 4℃ for 10 min.Then，the supernatant of the bacteria liquor was abandoned and the centrifugal tube was kept upside down，and trace liquid in the tube was drained.After this，pre-cooled buffer containing 100 mmol CaCl2of equal volume into the centrifugal tube was added to bacteria.The suspended bacteria were centrifuged at 4 100 r/min at 4℃ for 10 min.The supernatant was disposed and the 1.2 mL pre-cooled liquid was used to suspend bacteria body.At last，100 μL buffer containing 100 mmoL CaCl2was distributed to the bacteria body in 1.5 mL eppendorf tubes.These competent bacteria should be converted at 4℃ for 36 hours，and the rest shall be added with sterilized glycerol of concentration 25%，and preserved at-80℃.

Recombinant plasmid extraction——After the positive clone was identified by the PCR method，the positive clone was inoculated into the test tube containing 4 mL LB liquid culture medium(containing 100 mg/L penicillin).The bacteria was incubated at 250 r/min at 37℃ and shaken for 5 hours.When the bacteria grew to a saturated state，the bacteria liquid was placed to 1.5 mL centrifuge tube，and centrifuged at 10 000 r/min for 1 min. The bacteria were collected and the supernatant was removed.The plasmid was extracted according to the standard procedure supplied in the plasmid extraction reagent kit.The plasmid solution is kept at-20℃.

Cloning of human CD44，CD133，ABCG2 and plasmid construction——The CD44，CD133 and ABCG2 antigen were analyzed for their respective antigenic epitopes by Genestar.After analysis，the gene encoding protein fragment with sound immunogenicity was chosen.

CD44(639bp):Truncated Pr:531～742 212AA

Homology with mouse:69%

Forward primer:

CGGGATCCACTCTGACATCAAGCAATAG BamHⅠ

Tm=64.7，GC%=50%

Reverse primer:

CCGCTCGAGTTACACCCCAATCTTCATG XhoⅠ

Tm=70.4，GC%=53.6%

CD133(615bp):Truncated Pr:512～715，204AA

Homology with mouse:53%

Forward primer:

CGGGATCCGAAAAACTGATCTGTGAACC BamHⅠ

Tm=68.3 GC%=50.0%

Reverse primer:

CCGCTCGAGTTACCTAGTTACTCTCTCC XhoⅠ

Tm=73.1 GC%=53.6%

ABCG2(579bp):Truncated Pr:193～385AA

Homology with mouse:78%

Forward primer:

CCGGAATTCAGGACTAGTATAGGAATGGAG EcoRⅠ

Tm=67.4 GC%=46.7%

Reverse primer:

CCGCTCGAGTTAGAATGAACGCTTG

GAAACC XhoⅠ

Tm=75.3 GC%=51.6%

The incorporated 5’BamHⅠ，EcoRⅠ and 3’XhoⅠrestriction sites are shown in bold.By using the Advantage one-step RT-PCR kit(Clontech，CA，USA)，the coding region of human CD133，CD44 and ABCG2 cDNA was respectively cloned from the plasmids containing human CD133，CD44 and ABCG2 genes，which were gifts from the Protein Interaction Lab of Beijing Protein Research Center.According to the manufacturer’s procedures，the PCR amplification was performed using a reaction mix containing the following reagents:2 μL of 10×PCR buffer(including 15 mmol MgCl2)，1.6 μL of 10 mmol dNTP mixture，0.4 μL of 10 μmol forward primer，0.4 μL of 10 μmol reverse primer，1 μL of DNA template，0.2 μL of Ex-Taq DNA polymerase and 14.4 μL of deionized H2O.

The PCR was performed according to the following standard procedures(Table 1).For CD44 PCR reaction，the PCR consisted of an initial reaction for 8 min at 94℃，30 cycles for 30 s at 94℃，30 s at 58℃，30 s at 72℃，and final extension for 8 min at 72℃.For CD133 PCR reaction，the PCR consisted of an initial reaction for 5 min at 94℃，30 cycles for 30 s at 94℃，30 s at 53℃，45 s at 72℃，and final extension for 7 min at 72℃.For ABCG2 PCR reaction，the PCR consisted of an initial reaction for 5 min at 94℃，30 cycles for 30 s at 94℃，30 s at 51℃，30 s at 72℃，and final extension for 7 min at 72℃.The resulting PCR products were separated by 1.5%agarose gel under a constant voltage of 150 V.

Table 1 The optimal parameters of PCR experiment for three biomarkers

The PCR products were gel purified by PCR recovery reagent kit(Omega).After then，the PCR products were digested with the restriction enzymes EcoRⅠand XhoⅠ.The enzyme restriction procedure was performed using a reaction mix containing the following reagents:2 μL of PCR product，10×K buffer，0.5 μL of EcoRⅠ，0.5 μL of XhoⅠ，14 μL of deionized H2O(20 μL system).Digested fragments were electrophoresed in a 1.5%agarose gel and purified.Similarly，the expression vector pET32a and pGEX-4T-1 were also digested by the restriction enzymes EcoRⅠ and XhoⅠ.The enzyme restriction procedure was performed using a reaction mix containing the following reagents:5 μL of pET32a(Fig.1)or pGEX-4X-1(Fig.2)，2 μL of 10×K buffer，1.5 μL of EcoRⅠ，1.5 μL of XhoⅠ，32 μL of deionized H2O.Then the enzyme cutting was carried out in 37℃ water bath for 4 hours.The targeted gene and the expression plasmids was digested fragments were electrophoresed in a 1.5%agarose gel and purified with the gel recovery reagent kit.Then the digested targeted fragments and the expression vectors pET32a and pGEX-4T-1 were ligated using a reaction mix containing the following reagents as described:7 μL of targeted fragment after digestion，1 μl of digested plasmid，1 μL buffer，1 μL of T4 DNA ligase，7 μL deionized H2O.Then the mixture was mixed thoroughly and centrifuged for a short time.After then，the ligation procedure was performed overnight at 4℃ for 16 hours.

Plasmid transformation——Plasmid transformation was performed according to a standard procedure.Briefly，5 μL ligation product was taken out of the mixture and added to 100 μL competence cell.The plasmid transformation included the positive control(complete plasmid)and negative control(empty plasmid).These plasmids were placed in ice bath for 30 min.After that，the competent cells were transferred to 42℃ water bath for 90 sec (note:do not shake)，and quickly put it to ice bath for 2 min.Then，200 μL pre-heated LB liquid culture medium(without penicillin)was added to the competent cells and the medium containing cells was gently homogenized and slowly recover for 45 min at 37℃ and 100 r/min.At last，the competent cells were incubated overnight 37℃ in LB panel containing 100 mg/L ampicillin(note:the LB panel should be placed upside down).

Recombinant plasmid identification——After an overnight incubation at 37℃，single colony was taken and inoculated to the test tube containing 2 mL LB liquid culture medium(including of 100 mg/L penicillin).The test tube containing single colony was incubated at 250 r/min at 37℃ overnight.The recombinant plasmid identification was performed according to the PCR method.Briefly，1 μL bacteria liquid was taken out as template.Then PCR reaction was carried out according to the conditions identical to gene group amplification condition.The amplification PCR products were undergone by 1%agarose gel electrophoresis.The resulting expression vectors containing the CD133，CD44 and ABCG2 were identified by restriction enzyme digestion and DNA sequence analysis.As a result，we successfully obtained the expression vector pET32a and pGEX-4T-1(pET32a-CD133，pGEX-CD133， pET32a-CD44， pGEX-CD44，pET32a-ABCG2 and pGEX-ABCG2).The recombinant plasmids were transformed into E.coli DH5α.and the transformants were confirmed by DNA sequencing.

Human CD133，CD44，and ABCG2 expression——Plasmids containing CD133，CD44 and ABCG2 were transfected into E.coli strain BL-21 (DE3).Individual clone was shaken at 37℃ in LB medium with 100 mg/L ampicillin overnight. The recombinant plasmids(pET32a-CD133，pGEXCD133，pET32a-CD44，pGEX-CD44，pET32a-ABCG2 and pGEX-ABCG2)were transformed into E.coli BL21(DE3)cells.Transformants were grown in LB medium(tryptone 10 g/L，yeast extract 5 g/ L，NaCl 10 g/L，and ampicillin 100 mg/L).The high expression clones were obtained according to the results of SDS-PAGE analysis and cultured in LB medium overnight at 37℃ for small-scale culture.The overnight culture(100 μL)was then inoculated into 5 mL of the fresh medium described above at 37℃ until the optical density(A600) reached 0.5，and protein expression was induced by adding IPTG to a final concentration 1 mmol. After induction for 4 h，the cells were separated from the culture medium by centrifugation at 8 000 g for 15 min，and the cellular pellet was then resuspended in 20 mmol sodium phosphate buffer，pH 7. 2，containing 150 mmol NaCl(PBS)and the cells were lysed thoroughly by ultrasonication at 4℃，Bacterial debris was then removed by centrifugation (14 000 g，15 min，4℃)and the supernatant was collected for analysis.For a standard denaturing 10 %sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE)analysis，all samples were incubated at 100℃ for 5 min in 6×SDS-PAGE loading buffer(300 mmol Tris-HCl，pH 6.8;30% (V/V)glycerol;10%(V/V)SDS;6 mmol dithiothreitol;0.12%(V/V)bromphenol blue)and then separated by SDS-PAGE under separated voltage.After the protein was separated，the isolated proteins were stained with Coomassie brilliant blue R-250 overnight at room temperature.

Large-scale preparation of recombinant protein——To prepare recombinant protein CD133，CD44，and ABCG2 in large amounts，the expression host BL21(DE3)cells harboring the recombinant plasmids were cultured in 10 mL of LB medium and incubated overnight in a rotary shaker at 37℃(at 250 r/min).The overnight culture was largely diluted at 100-fold(1 liter total volume)with LB medium supplemented with 100 mg/L ampicillin at 37℃.As soon as an absorbance of 0.5 at 600 nm was reached，the protein was induced to express by adding IPTG to a final concentration of 1mmol and incubated for 4 h at 37℃ at 250 r/min as described above.The induced cells were harvested by centrifugation at 10 000 g at 4℃ for 15 min.After then，the pelleted cells were lysed by adding 50 mL lysis buffer(20 mmol Tris-HCl，pH 7.5，containing 100 mmol NaCl，5 mmol EDTA，5 mmol DTT，5 mmol PMSF，100 mg/L DNase I，and 200 mg/L lysozyme)for each gram(wet weight)of cells at 25℃ for 1 h.The cells were lysed by sonication by Ultrasonic Cracker(obtained from Ningbo Xinzhi Biotech Co.Ltd)at 400 W for 100 cycles(3 s working，5 s free)in ice-water bath.After centrifugation at 12 000 g for 30 min，the supernatants were designated as the cytosolic fraction.Inclusion bodies were purified as described previously.Briefly，the pellets were washed for three times in washing buffer(20 mmol Tris-HCl，pH 7.5，containing 5 mmol EDTA，5 mmol DTT，2 M urea，5 mmol PMSF，and 1%Triton X-100)and were resuspended in 10 mL of inclusion body solubilization buffer(20 mmol Tris-HCl，pH 8.0，containing 8 mol urea，500 mmol NaCl，and 5 mmol imidazole) and then vortexed until the pellets dissolved to yield the inclusion body fraction.

Western blotting analysis——The six target proteins，GST-CD133，His-CD133，GST-CD44，His-CD44，GST-ABG2 and His-ABG2 were analyzed by SDS-PAGE under reducing conditions using 10% gels.The separated proteins were transferred to the PVDF membrane for the Western blotting analysis. After being blocked with 8 mL of 10%non-fat milk in PBST(PBS containing 0.02%Twreen-20)，the membrane was washed for three times with PBST for 12 min and incubated with a 1∶6 000 dilution of rabbit anti-human GST polyclonal antibody or rabbit anti-His polyclonal antibody(Santa cruz Biotechnology)for 1.5 h at 37℃.After washing thrice with PBST，horseradish peroxidase(HRP)-labeled goat anti-mouse IgG(US Biological，MA，USA)was added to the membrane and visualized by 3，3’-diaminobenzidine(Sigma)as a peroxidase substrate.

2 Results

Construction of the recombinant vector——The PCR products of CD133，CD44 and ABCG2 were shown in Fig.3.The length of all the three PCR products was about 550～600 bp，which is consistent with the predicted target gene fragment. These PCR fragments were cloned to vectors using the cloning strategy described in Fig.4.Briefly，after the correct DNA fragments were cut by the appropriate restrict enzymes，the DNA fragments were then cloned into the pET32a or pGEX-4T-1 expression vectors.Then the target gene in these vectors was sequenced.The pET32a and pGEX-4T-1 plasmids have the ampicillin resistance gene for selection in E.coli.Plasmids carrying the target genes can be selected on LB plates containing ampicillin. In this experiment，the strain DH5α was transformed with the above constructed plasmids and screened in LB medium containing ampicillin(100 mg/L).The positive colony was further confirmed by PCR(Fig.5).Our results indicated that，according to each target gene，there are several correct clones.Therefore，we can choose any of the correct clones to do in the next step.

Fig.3 PCR products of CD44，CD133 and ABCG2 were analyzed by 1.5%agarose gel electrophoresis

Fig.4 The construction fragments strategy of expression plasmid

Fig.5 The positive colonies of CD44，CD133 and ABCG2 were confirmed by PCR

Expression of the recombinant protein——The strain BL21(DE3)was selected as the expression host strain，which was deficient in the Ion protease and lacked the outer membrane protease(ompT) that degraded proteins during the process of purification，so that proteins were more stable in the host.The recombinant protein production was carried out under conditions whereby degradation of the fusion proteins was minimized.The construction of each of theabove sixexpression vectors，pET32a-CD133，pGEX-CD133，pET32a-CD44，pGEX-CD44，pET32a-ABCG2 and pGEX-ABCG2，should produce a recombinant target protein about 42-46 kDa.Induction of the strong T7 promoter controlling the expression of the target protein in BL21(DE3)with 1 mmol IPTG produced recombinant target protein after 2 h.The recombinant protein is the major band of about 42～46 kDa at the time point of induction(Fig.6).Our results demonstrated that the expressed fusion proteins CD44，CD133 and ABCG2 had the expected correct molecular weight.

Fig.6 Expression of the recombinant protein CD44，CD133 and ABCG2

Western blotting analysis of the target protein——To insure that the expressed recombinant proteins were the CD133，CD44 and ABCG2 we had designed，the recombinant proteins were subjected to Western-blotting analysis.The recombinant protein showed high immunoreactivity with anti-GST antibody or anti-His antibody(Fig.7).The resultsconfirmed the successfulexpression of CD133，CD44 and ABCG2.

The recombinant plasmid identification was performed according to the colony PCR method. Briefly，1 μL bacteria liquid was taken out as template.Then PCR reaction was carried out according to the conditions identical to gene group amplification condition.The amplified PCR products were separated by 1%agarose gel electrophoresis.

Protein sample were prepared as follows:the whole cell lysate before induction(lane 1)and after 4 h induction(lane 2).For SDS-PAGE analysis，samples were incubated at 100℃ for 5 min in 6× SDS-PAGE loading buffer(300 mmol Tris-HCl，pH 6.8;30%(V/V)glycerol;10%(V/V)SDS;6 mmol dithiothreitol;0.12%(V/V)bromphenol blue)and then separated by 10%SDS-PAGE.The separated proteins were stained with Coomassie brilliant blue R-250.Lane 1，total protein from uninduced cells;lane 2，total protein from induced cells.

Fig.7 The expression of target proteins was confirmed by Western blotting

The six target proteins，GST-CD133，His-CD133，GST-CD44，His-CD44，GST-ABG2and His-ABG2 were separated by SDS-PAGE under reducing conditions using 10% gels.In the under picture，line 1 is marker;line 2 is empty BL21 vectors;line 3 is CD133-GST;line 4 is ABCG2-His; line 5 is CD44-GST.

3 Discussion

The E.coli expression system is the most frequently used exogenous protein expression system nowadays.It has distinctive gene background，rapid growth and short growth cycle.It is suitable for large scale incubation and there are a lot of high efficient expression vectors for selection，which makes it the most usually used system for expressing exogenous gene for people.However，in the process of expressing exogenous gene，not all the genes can be successfully expressed with high expression yield. The major factors affecting the expression of exogenous gene in E.coli are the selection of expression vectors(including promoter)and host bacteria，selection of cDNA codon，primary and secondary structure of mRNA，culture conditions of bacteria，etc.In the following we will discuss the common impactive factors.

3.1 Impact of Expression Vectors and Host Bacteria

The expression vector has an important effect upon the expression of exogenous gene，it not only requires amount of highly correct gene expression，but also needs to make sure have a stable amount multiplied plasmids in the host bacteria.The copy number of plasmids in an E.coli cell could reach several hundred.The plasmids are normally in random distribution in the process of cell division. When plasmids don’t take exogenous gene，it’s reproduce ability is very high.However，if the cell has a high plasmid copy number and the exogenous gene it brought along is toxic which will decrease reproduce ability of plasmid in host cell.After the plasmid vector with exogenous gene is transformed into the E.coli competent cell，there will be a series of physiological effects which would effect the stability of recombinant plasmid，for example for the E.coli with recombinant plasmid in the culture process，due to the missing/loss，due insertion and recombination of DNA to damage of part of the function zones of the plasmid，and uneven distribution of recombinant plasmids in the process of cell division.Moreover，there will be host bacteria without any plasmid or change of plasmid copy number. All those factors may affect the expression of exogenous gene［14-15］.The promoter carried by vector is the recognition site and integration site for RNA polymerase.The ideal promoter for exogenous gene expression can initiate high efficient transcription. The pET vector is an expression system which has the most powerful function for expression of recombinant proteins in E.coli ever since.The target gene is cloned into pET plasmid vector，and is subjected to the control of bacteriophage T7 strong transcription and translation(optional)signal.Then the expression is initiated by T7 RNA polymerase offered by the host cell.T7 RNA polymerase is very effective and selective.With adequate induction，almost all the cell resources are used to express the target protein.In only several hours after induction，the target protein can usually reach more than 50%of the total proteins in the cell.Although the system is very powerful，the protein expression can be weakened readily by reducing the concentration of inducer.Reducing the expression level may raise the production of soluble portion of certain target proteins.Another important advantage of the system is that under non-inductive condition，the target gene can be kept in dormant status completely without transcription.In this case，we have two methods can be used to control plasmid expression in the suitable time.One of it can be called one-step system. When we want plasmid expression;we need add a special reagent which can promote plasmid expression immediately.However，there has a problem for this one-step system，we need inject this special reagent into E.coli，which is very complex to operate it.Another method is T7 induced system.This is a two steps system.First，we need add Lac operator (IPTG)to promote this special E.coil expression. And special E.coli will produce amount of T7 RNA polymerase to go to promote plasmid in next step. Finally，we can indirect control expression time of plasmid and on time.The pGEX system was developed by Pharmacia Company.It contains a compatible chromatography medium Glutathione Sepharose 4B for purification of expressed proteins.Our results indicate that both of the two expression vectors used in this experiment，pET and pGEX，can efficiently express the target proteins，CD133，CD44 and ABCG2.

3.2 Configuration of the Expression Products

The prokaryotic expression system，which lack of the modification system for proteins in eukaryote，the hydrophobic action and ion effect，right folding of proteins，reductive environment of host cells and degeneration function，etc.will result in the formation of inclusion bodies.The biggest problem for expression of exogenous gene in the E.coli cell is that insoluble inclusion bodies would be generated.Inclusion body is the non-active solid particle formed by interring condensation of proteins expressed by bacteria，and it has strong refraction. There are many theories explaining the cause for the inclusion body formation，and it is now generally thought that the natural configuration of proteins is not folded and formed in one step automatically，instead，it gradually takes place by many interim stages with the assistance of some auxiliary proteins.The formation of inclusion bodies is also related to the over-expression of proteins，and thus the proteins have no adequate time to fold the peptide chain.The electrical charge of the protein，the temperature of culture，pH value of the culture medium，composition of culture medium are all related to formation of inclusion bodies.The renaturation of proteins from the inclusion body is a cosmopolitan problem，and there is no general method.There is even no reliable rule，and it can only be tried［16］. Each product need follow respective order of different experiment.When we want to prepare monoclonal antibodies by immunizing animals with the proteins，the inclusion body should be a better choose.

3.3 Purification of Recombinant Proteins

When people want to purified recombinant proteins they need a special technique to separate target proteins from host cells.The currently usually used tags are GST and His.The inclusion bodies can be production，fast speed，and low purification cost distinguished.And inclusion bodies are helpful to prevent the degradation of expressed proteins by protease［17］.The inclusion bodies have stronger immunogenicity，so they can be used directly for animal immunization.Ultrasonic crack method we have further purified the inclusion bodies，and the purity of the fusion proteins is more than 80%.

3.4 Cultivation Condition for Bacteria

The growth of host bacteria is depended on cultivation condition，which has certain impact on the expression of exogenous genes.Controlling the growth of bacteria has important meaning for increasing the plasmids stability，reducing the accumulation of metabolism，and increasing the production rate of exogenous proteins.In order to increase the stability of plasmids in the process of bacteria culture，the culture of bacteria is divided into two phases:phase 1，growing the bacteria to certain density;phase 2，inducing the expression of exogenous genes.Some researches studied the relation among specific production rate，plasmid copy number，and target product［18］.Based upon the above discovery，we have taken the approach to express recombination proteins at 30℃.The stability of expression products at this temperature is higher than at 37℃.We also have carried out induction at the logarithmic growth period(OD value is between 0.5～0.8).The results showed that it is easier to induce the synthesis of exogenous proteins.If the induction is conducted ahead of the time，the bacteria growth is slow and the exogenous proteins have low production.If the induction is too late，the bacteria will become very maturity，which is not suitable for genes expression.The culture time after induction differs with different expression vectors and promoters;however the induction time does not prefer to be long.The heat shock protein generated after in-duction may trigger the protein hydrolase，which will degrade the expression products.

3.5 Detection of Expression Products

There are following detection methods for expression products of exogenous genes in E.coli: Firstly，SDS-PAGE is usually used to detect the expression of target proteins，the relative molecular weight of proteins，and the purity of the purified products.After electrophoresis，the Coomassie Brilliant Blue Dye or silver dye are used to stain the products in order to highlight the target protein stripes.In this experiment Coomassie Brilliant Blue R-250 is used for pigmentation.Secondly，it is Western Blot analysis，which applies antibodies that can specifically bind with the target proteins for protein transferring print hybrid in order to confirm the homogeneity and specification of expression products separated by SDS-PAGE.Thirdly，it is biological activity determination.The inspection and demonstration for bioactivity are the most powerful evidence for judging whether the exogenous genes have been expressed.For the bacteria induced for expression after ultrasonic crack，the existence of expression products should be identified by SDSPAGE.In general，the proteins existing in supernatants have bioactivity，and the proteins in inclusion bodies need to be denatured，split，and then undergo renaturation before the biological activity can be measured［19］.Our experiment has carried out identification for the expression of exogenous genes with SDS-PAGE and Western Blot.The protein expressed in inclusion bodies has ability to prevent the protease from degrading the expressed protein，and is readily separated.As it has stronger immunogenicity than that of soluble protein and can be used directly for animal immunization.So there is no need for biological activity inspection for the protein［20-23］.

Based upon the genes of three proteins donated by partner lab，we has designed three pairs of primers，which can be used to amplify the DNA fragment of about 579～639 bp in the three cancer stem cell marker gene，CD133，CD44 and ABCG2. These three gene fragment encoded proteins were successfully expressed in the prokaryote system.In order to resolve the interference of antibodies against tags in the selection，each protein is expressed in two tag systems.One of them is GST tag system;the other is HIS tag system.80%of the expression products of exogenous genes in E.coli are inclusion bodies.The six proteins expressed in this experiment are all in the forms of inclusion bodies. Through the method of ultrasonic crack we have further purified the inclusion bodies，and the purity of the fusion proteins was more than 80%［24-27］.

4 Conclusions

In summary，we have successfully expressed the CD133，CD44 and ABCG2 target proteins in the prokaryote system.Next，we plan to prepare specific monoclonalantibodiesby immunizing BALB/c mice with these three proteins.

［1］ Srinivas P R，Kramer B S，Srivastava S.Trends in Biomarker Research for Cancer Detection［J］.Lancet Oncol，2001，2(11):698-704.

［2］ Jain K K.Cancer Biomarkers:Current Issues and Future Directions［J］.Curr Opin Mol Ther，2007，9 (6):563-571.

［3］ Bjerkvig R，Tysnes B B，Aboody K S，et al.Opinion: the Origin of the Cancer Stem Cell-current Controversies and New Insights［J］.Nat Rev Cancer，2005，5 (11):899-904.

［4］ Shipitsin M，Polyak K.The Cancer Stem Cell Hypothesis:in Search of Definitions，Markers，and Relevance［J］.Lab Invest，2008，88(5):459-463.

［5］ Miraglia S，Godfrey W，Yin A H，et al.A Novel Fivetransmembrane Hematopoietic Stem Cell Antigen:Isolation，Characterization，and Molecular Cloning［J］. Blood，1997，90(12):5013-5021.

［6］ Weigmann A，Corbeil D，Hellwig A，et al.A Novel Microvilli-specific Polytopic Membrane Protein of the Apical Surface of Epithelial Cells，is Targeted to Plasmalemmal Protrusions of Non-epithelial Cells［J］. Proc Natl Acad Sci USA，1997，94(23):12425-12430.

［7］ Shmelkov S V，Butler J M，Hooper A T，et al.CD133 Expression is Not Restricted to Stem Cell，and Both CD133+and CD133-Metastatic Colon Cancer Cells Initiate Tumors［J］.J Clin Invest，2008，118(6): 2111-2120.

［8］ Hermann P C，Huber S L，Herrler T，et al.Distinct Populations of Cancer Stem Cells Determine Tumor Growth and Metastatic Activity in Human Pancreatic Cancer［J］.Cell Stem Cell，2007，1(3):313-323.

［9］ Lesley J，Hyman R，Kincade P W.CD44 and Its Interaction with Extracellular Matrix［J］.Adv.Immunol，1993，54:271-335.

［10］ Patrawala L，Calhoun T，Schneider-Broussard R，et al.Highly Purified CD44+Prostate Cancer Cells from Xenograft Human Tumors are Enriched in Tumorigenic and Metastatic Progenitor Cells［J］.Oncogene，2006，25(12):1696-1708.

［11］Polgar O，Robey R W，Bates S E.ABCG2:Structure，F(xiàn)unction and Role in Drug Response［J］.Expert Opin Drug Metab Toxicol，2008，4(1):1-15.

［12］Zhou S，Schuetz J D，Bunting K D，et al.The ABC Transporter Bcrp1/ABCG2 is Expressed in a Wide Variety of Stem Cells and is a Molecular Determinant of the Side-population Phenotype［J］.Nat Med，2001，7:1028-1034.

［13］K?hler G，Milstein C.Continuous Cultures of Fused Cells Secreting Antibody of Predefined Specificity［J］.Nature，1975，256:495-497.

［14］Mullis K B，F(xiàn)aloona F A.Specific Synthesis of DNA in Vitro Via a Polymerase-catalyzed Chain Reaction［J］.Methods Enzymol，1987，155:335-350.

［15］Jebai F，Hanoun N，Hamon M，et al.Expression，Purification，and Characterization of Rat Aromatic L-amino Acid Decarboxylase in Escherichia Coli［J］.Protein Expr Purif，1997，11(2):185-194.

［16］Hayashi N，Matsubara M，Takasaki A，et al.An Expression System of Rat Calmodulin Using T7 Phage Promoter in Escherichia Coli［J］.Protein Expr Purif，1998，12(1):25-28.

［17］Borgi I，Gargouri A.A Spontaneous Direct Repeat Deletion in the pGEX Fusion Vector Decreases the Expression Level of Recombinant Proteins in Escherichia Coli［J］.Protein Expr Purif，2008，60(1):15-19.

［18］Feng X J，Wang J H，Shan A S，et al.Fusion Expression of Bovine Lactoferricin in Escherichia Coli［J］. Protein Expr Purif，2006，47(1):110-117.

［19］Colleluori D M，Tien D，Kang F，et al.Expression，Purification，and Characterization of Recombinant Cyanovirin-N for Vaginal Anti-HIV Microbicide Development［J］.Protein Expr Purif，2005，39(2):229-236.

［20］Joshi B H，Puri R K.Optimization of Expression and Purification of Two Biologically Active Chimeric Fusion Proteins that Consist of Human Interleukin-13 and Pseudomonas Exotoxin in Escherichia Coli［J］. Protein Expr Purif，2005，39(2):189-198.

［21］Gupta J C，Raina K，Talwar G P，et al.Engineering，Cloning，and Expression of Genes Encoding the Multimeric Luteinizing-hormone-releasing Hormone Linked to T Cell Determinants in Escherichia Coli［J］.Protein Expr Purif，2004，37(1):1-7.

［22］Liu X R，He Z M，Zhou M，et al.Purification and Characterization of Recombinant Extracellular Domain of Human HER2 from Escherichia Coli［J］.Protein Expr Purif，2007，53(2):247-54.

［23］Liu Y，Zhao T J，Yan Y B，et al.Increase of Soluble Expression in Escherichia Coli Cytoplasm by a Protein Disulfide Isomerase Gene Fusion System［J］. Protein Expr Purif，2005，44(2):155-161.

［24］Mohammadian-Mosaabadi J，Naderi-Manesh H，Maghsoudi N，et al.Improving Purification of Recombinant Human Interferon Gamma Expressed in Escherichia Coli，Effect of Removal of Impurity on the Process Yield［J］.Protein Expr Purif，2007，51(2):147-156.

［25］Lan P C，Tseng C F，Lin M C，et al.Expression and Purification of Human Placenta Lactogen in Escherichia Coli［J］.Protein Expr.Purif，2006，46(2):285 -293.

［26］Cao S，Liu Z，Guo A，et al.Efficient Production and Characterization of Bacillus Anthracis Lethal Factor and a Novel Inactive Mutant rLFm-Y236F［J］.Protein Expr Purif，2008，59(1):25-30.

［27］St?cker M，Pardo A，Hetzel C，et al.Eukaryotic Expression and Secretion of EGFP-labeled Annexin A5［J］.Protein Expr Purif，2008，58(2):325-331.