A novel TIR-NBS-LRR gene regulates immune response to Phytophthora root rot in soybean

Li Zhou,Sushuang Deng,Huidong Xuan,Xingxing Fan,Ruidong Sun,Jinming Zhao,Haitang Wang,Na Guo,Han Xing

National Center for Soybean Improvement/Key Laboratory of Biology and Genetics and Breeding for Soybean,Ministry of Agriculture/State Key Laboratory of Crop Genetics and Germplasm Enhancement/Nanjing Agricultural University,Nanjing 210095,Jiangsu,China

Keywords:Soybean(Glycine max(L.)Merr.)Phytophthora sojae gma-miR1510 GmTNL16 SA and JA pathway

ABSTRACT Phytophthora root rot(PRR),caused by Phytophthora sojae,is a devastating disease of soybean.The NBSLRR gene family is a class of plant genes involved in disease resistance.miRNA mediates plant response to biotic stresses by regulating the expression of target genes at the transcriptional or post-translational level.Glyma.16G135500,encoding an NBS-LRR-type protein,is a target of gma-miR1510 that responds to pathogen infections.We cloned and overexpressed Glyma.16G135500(naming it GmTNL16)and knocked down miR1510 using short tandem target mimic technology to identify the roles of the GmTNL16/gma-miR1510 pair in the interaction of soybean and the oomycete.By overexpressing GmTNL16 in transgenic hairy roots of soybean,we showed that biomass of P.sojae was lower in overexpressing hairy roots than in control roots.Thus,miR1510 expression was reduced upon P.sojae infection,reflecting the induced expression of GmTNL16 conferring resistance to P.sojae in soybean.Differentially expressed genes were enriched in plant-pathogen interaction,plant hormone signal transduction,and secondary metabolism by RNA sequencing analyze.In particular,jasmonate and salicylic acid pathway-associated genes,including JAZ,COI1,TGA,and PR,responded to P.sojae infection.All of these results indicate that the GmTNL16/gma-miR1510 pair participates in soybean defense response via the JA and SA pathways.

1.Introduction

Soybean(Glycine max(L.)Merr.)is a source of protein and oil worldwide.Phytophthora root rot(PRR),caused by Phytophthora sojae,is a devastating disease of soybean that causes seedling lodging and root rot from germinated seedlings to mature plants.PRR was first discovered in 1948 in Indiana,USA[1].In 1989,the disease first occurred in northeast China[2]and then spread to other areas of China.Breeding soybean disease-resistant cultivars is the most effective and economic method of controlling PRR.

Thirty-seven genes conferring resistance to P.sojae(Rps)have been identified,including Rps1[3],Rps7[4],and Rps9[5].However,P.sojae shows high variability,leading to the development of new races.Recent studies[6]have proposed a‘‘zigzag”model to describe the coevolution of pathogens and host plants.The first layer of the immune system is triggered by pattern-recognition receptors(PRRs)located on the cell membrane that directly recognize the pathogen-associated molecular patterns of pathogens,a response called pattern-triggered immunity(PTI).The second layer of the immune system is triggered by resistance(R)proteins located in the cell,directly or indirectly sensing the effectors of pathogenic bacteria.This response is called effector-triggered immunity(ETI).

NBS-LRR family genes act in plant immune response.Most resistance(R)genes contain nucleotide binding-site(NBS)and leucine-rich repeat(LRR)domains that are responsible for downstream signaling and for the regulation of some pathogenresistance genes.NBS-LRR proteins can be divided into two subfamilies based on the conserved domains of the amino terminal:NBS-LRR with a coiled coil domain(CNL),and NBS-LRR with Toll/interleukin-1-receptors(TNL).TNL genes are found in eudicot plants,while CNL genes are found in both eudicots and monocots[7].Many NBS-LRR family genes regulate plant resistance to pathogens in a variety of plant species.In a recent study[8],NBS-LRR genes colocalized with disease-resistance quantitative-trait loci,supporting the notion that these genes contribute to disease resistance.Some genes increase soybean resistance to P.sojae,including GmaPPO12[9],GmBTB/POZ[10],GmDAD1[11],and the bHLH transcription factor GmPIB1[12].However,the roles of NBS-LRR genes in soybean resistance to P.sojae remain largely unknown.

In addition to natural immune receptors,small RNA(sRNA),including microRNAs(miRNAs)and small interfering RNAs(siRNAs),mediate gene silencing in plants,a response considered to be an alternatives system of defense against invasion by viruses and other pathogens[13].miRNAs are endogenous noncoding single-stranded RNAs with a length of 20-24 nucleotides(nt)and are widely present in eukaryotes[14].Much evidence suggests that miRNAs are key regulators of gene expression and function in plant immune response.miR393 was first found in response to pathogen infection in Arabidopsis[15].miR164a was reported[16]to be involved in rice immunity against Magnaporthe oryzae.MiR858 controls resistance to pathogen infection by cleaving transcripts of flavonoid-specific MYB factor genes in Arabidopsis[17].MiR1885 directly silences the TIR-NBS-LRR class of the R gene BraTNL1[18].In tomato,overexpression of miR482c reduced the expression of SlCNL,increasing plant susceptibility[19].

miR1510 can respond to multiple pathogens,including P.sojae and soybean mosaic virus[20,21].A previous study[22]showed that gma-miR1510 represses the resistance of soybean to P.sojae and that Glyma.16G135500(GmTNL16)is one of its valid target genes.GmTNL16,a TIR-NBS-LRR type R gene,was up-regulated in soybean during infection with P.sojae.However,the functional roles of GmTNL16 in the soybean-P.sojae interaction remain to be determined.The aim of this study was to identify the role of the GmTNL16/gma-miR1510 pair in the interaction between soybean and P.sojae,using overexpression of GmTNL16 and silencing of gma-miR1510.

2.Materials and methods

2.1.Culture of plant materials and P.Sojae

Williams 82,a soybean cultivar with resistance to P.sojae,was used for expression analysis.The cultivar Williams,which is susceptible to P.sojae isolate P6497,was used for gene transformation.

P6497 was cultured in the dark on a 1.5% V8 juice agar plate medium at 25 °C.For zoospore preparation,freshly cultured P6497 hyphae were inoculated into V8 liquid medium in a petri dish and cultured at 25°C for 3 days in the dark.The hyphae were then washed three times with sterile distilled water and kept in the dark at 25 °C to induce sporangia.Zoospores were released after about 12 h of incubation.

2.2.Stress treatment

For phytohormone treatment,Williams 82 seeds were planted in vermiculite and grown in a greenhouse(16-h light/8-h dark at 25 °C)for seven days,after which roots were cleaned and submerged in one of three solutions:200μmol L-1methyl jasmonate(MeJA),200μmol L-1salicylic acid(SA),and 10μmol L-1flg22(a synthetic peptide of 22 conserved amino acids at the N-terminal of prokaryotic bacterial flagellin).Samples were harvested and stored at-80 °C until RNA extraction.

2.3.Gene expression analysis

Total RNA was extracted using Trizol(Invitrogen,Carlsbad,CA,USA)according to the manufacturer’s instructions.A reversetranscription kit,HiScript II Q RT SuperMix for qPCR(with added gDNA wiper)(Vazyme,Nanjing,Jiangsu,China)to obtain cDNA of GmTNL16.For miRNA,the first-strand cDNA was generated from equal amounts of total RNAs using miRNA 1st Strand cDNA Synthesis kit(by stem-loop)(Vazyme).Each cDNA was amplified by quantitative PCR using the ChamQ Universal SYBR qPCR Master Mix(Vazyme)with a Light Cycler 480.GmCons 4 and GmSnoR I were used as internal controls of GmTNL16 and gma-miR1510.The 2-ΔΔCTmethod was used to estimate the relative expression level of genes.Student’s t-test was used for significance analysis.

2.4.GmTNL16 gene cloning and vector construction

The precursor sequence and mature sequence of gma-miR1510 were obtained from the miRNA database DPMIND(http://cbi.njau.edu.cn/DPMIND/).The sequence of GmTNL16 was retrieved from Phytozome(https://phytozome.jgi.doe.gov/).Inter Pro online website(https://www.ebi.ac.uk/interpro/)was used to predict the GmTNL16 protein domain.

Primer 5 software was used to design amplification primers and cDNA from the root of Williams 82 was used as amplification template.The coding sequence of GmTNL16 was amplified by PCR with the primers listed in Table S1.A GmTNL16 overexpression vector was generated by amplification of full-length coding sequence of GmTNL16 and then inserted into the Sal I/Sma I sites of the pCB301 vector.

2.5.Subcellular localization of GmTNL16

The full-length CDS of GmTNL16 without termination codon for subcellular localization of GmTNL16 protein was inserted into the pBINGFP4 vector at Kpn I restriction sites,to generate 35S::GmTNL16-GFP4 construct.The empty 35S::GFP4 vector was used as a control.Plasmids containing 35S::GmTNL16-GFP4 and 35S::GFP4 were transformed separately into Agrobacterium tumefaciens strain GV3101 by electroporation.The bacterial suspension was infiltrated into the abaxial side of fully expanded 5-week-old tobacco(N.benthamiana)leaves.After infiltration,the plants were held in the dark for 48 h.Fluorescence of GFP4 was detected by a confocal fluorescence microscope(Zeiss,Germany).

2.6.Construction of silencing vector STTM1510

Using the sequence of gma-miR1510a(UUGUUGUUUUACCUAUUCCACCC)and gma-miR1510b(UGUUGUUUUACCUAUUCCACC),the oligonucleotide sequence for the STTM1510a,STTM1510ab,and STTM1510b silencing vectors was designed and inserted into pFGC5941(Table S1),as described by Tang et al.[23].Soybean hairy roots were then transformed by Agrobacterium-mediated transformation.

2.7.Soybean genetic transformation and selection

The plasmids OE-GmTNL16 and STTM1510 were transformed separately into A.rhizogenes K599 by electroporation.450μL YEP medium was then added,followed by shaking for 4-6 h at 28 °C.The bacterial suspension was centrifuged at 4500 r min-1for 2 min,the supernatant was discarded,and 50μL was pipetted onto solid medium of YEP with rifampicin and kanamycin.After two days a single clone was picked and validated by colony PCR.

Bacterial suspension(20μL)was added to 4 mL liquid medium and cultured at 28°C for 12-16 h.Full,high-quality soybean seeds were surface-sterilized with chlorine gas for 1 h and soaked in 200 mL ddH2O overnight.Agrobacterium was added to CCM liquid medium and mixed well to achieve an OD600of 0.6-1.0.The soybeans(split in half along the radicle)were placed into the bacterial solution,followed by shaking at 90 r min-1for 30 min,culture in the dark for 4-5 days at 25°C,and then placing in White medium and culture further to obtain soybean hairy roots.

Fig.1.Expression patterns of GmTNL16 in soybean.Seven-day-old plants were used.(A)Tissue expression of GmTNL16 in Williams.Transcription of GmTNL16 in roots,stems,and leaves.(B)Relative expression of GmTNL16 in response to salicylic acid(SA).Williams 82 roots were treated with 200μmol L-1 SA for indicated times.(C)Relative expression of GmTNL16 in response to methyl jasmonate(MeJA).Williams 82 roots were treated with 200μmol L-1 MeJA for indicated times.(D)Relative expression of GmTNL16 in response to flg22.Williams 82 roots were treated with 10μmol L-1 flg22 for indicated times.Transcript abundance of GmTNL16 was determined by qRT-PCR using GmCons 4 as internal control.Experiments were repeated three times.Asterisks indicate statistically significant differences(**,P＜0.01;***,P＜0.001).

OE-GmTNL16 transgenic hairy roots of soybean cultured about 3 weeks were verified by fluorescence microscopy and PCR.The positive transformed hairy roots of STTM1510 were verified by PCR and subjected to phenotypic analysis.

2.8.P.Sojae resistance assays

Phytophthora sojae was cultured on 10% V8 solid medium for 4 days.Its mycelium was cut into 3×3 mm pieces and inoculated on positive hairy roots,and the phenotype at 24 and 36 h was recorded.For zoospore inoculation,positive hairy roots were inoculated with 104mL-1zoospores and cultured in the dark at 25 °C,and samples were taken at 6 and 12 h post-inoculation(hpi).The P.sojae internal reference gene PsTEF and soybean internal reference gene GmCons 4 were used to measure biomass accumulation by qRT-PCR.

2.9.Library construction and sequencing

The hairy roots of OE-GmTNL16 and empty vector(EV)were collected and ground after 0 h and 12 h of treatment with P.sojae,and RNA sequencing(RNA-seq)by Biozeron company.Raw reads were checked for quality using qualimap 2.2.1（https://qualimap.bioinfo.cipf.es/).Clean reads of four transcriptomes were obtained by filtering out adapter sequences and low-quality reads from the original sequencing data,and then mapped to the soybean Wm82.a4 reference genome(https://www.soybase.org/dlpages/index.php)using Hisat2(https://ccb.jhu.edu/software/hisat2/index.shtml).R edge R package(http://www.bioconductor.org/packages/release/bioc/html/edgeR.html/)was used to identify differentially expressed genes(DEGs)with false discovery rate(FDR)≤0.05 and fold change(FC)≥2.Gene ontology(GO)enrichment analysis of the DEGs was performed with Goatools 0.9.9(https://github.com/tanghaibao/Goatools).Kyoto Encyclopedia of Genes and Genomes(KEGG)analysis of the differentially expressed genes was performed with KOBAS 3.0(http://kobas.cbi.pku.edu.cn/home.do).

3.Results

3.1.Identification of GmTNL16

GmTNL16 had two transcripts,GmTNL16.1 and GmTNL16.2,which matched the reference sequences in the Phytozome database(Fig.S1).Comparison of the cDNA and genomic sequences showed that the GmTNL16.1 genomic sequence comprised two introns and three exons.The deduced protein consisted of 1047 amino acid residues with a molecular weight of 119.79 kDa and a theoretical pI of 6.52.GmTNL16.2 consists of two introns and two exons encoding 951 amino acids with a molecular weight of 108.63 kDa and pI of 6.25(Fig.S2A).GmTNL16 contained a Toll/interleukin-1 receptor homology(TIR)domain,a NB-ARC domain,and a leucine-rich repeat(LRR)domain(Fig.S2B).Thus,GmTNL16 had a TIR-NBS-LRR domain and might function in soybean response to P.sojae.

3.2.The expression pattern of GmTNL16

The expression levels of GmTNL16 were measured by qRT-PCR.GmTNL16 showed highest expression in roots,where Phytophthora root rot occurred first,followed by leaves,and lowest in stems(Fig.1A).In response to SA and MeJA treatment,both GmTNL16.1 and GmTNL16.2 were induced(Fig.1B and C).The induction of GmTNL16.2 was more marked under SA treatment and the expression of GmTNL16.1 was more marked than that of GmTNL16.2 under MeJA treatment.These results suggested that GmTNL16 might contribute to soybean response to pathogens by regulating plant hormone signaling pathways.GmTNL16 expression increased at 15 min after treatment with flg22,decreased at 45 min,and then increased(Fig.1D).

3.3.GmTNL16 is localized in endoplasmic reticulum

To identify its subcellular location,GmTNL16.1 and GmTNL16.2 was expressed by fusion with GFP protein.The fluorescent signals showed that GmTNL16.1 and GmTNL16.2 were present on the cell membrane and nucleus,but fluorescence in the control was observed throughout the cell(Fig.2).Thus,GmTNL16.1 and GmTNL16.2 were present mainly in the plant cell membrane and nucleus.

3.4.Overexpression of GmTNL16 in hairy roots increased soybean resistance to P.Sojae

To confirm the role of GmTNL16,overexpressing GmTNL16.1(OE-GmTNL16.1)and GmTNL16.2(OE-GmTNL16.2)transgenic hairy roots were generated in Williams.Because hairy roots of OEGmTNL16.1 grew very slowly,OE-GmTNL16.2 was chosen for subsequent study.Expression was significantly higher in GmTNL16 than in the empty vector(EV)(Fig.3A).To assess the effect of GmTNL16.2 in the defense against P.sojae,both EV and transgenic hairy roots were inoculated with P.sojae.At 12 hpi,OE-GmTNL16.2 hairy roots showed shorter lesion length than the control at 24 and 36 hpi(Fig.3B).

Hairy roots were then inoculated with P.sojae zoospores and the relative biomass of P.sojae was measured.Fig.3C shows that the relative biomass of P.sojae was significantly lower in OEGmTNL16.2 transgenic hairy roots than in EV.Measurement of transcription levels of GmTNL16 during infection with zoospores of P.sojae revealed that GmTNL16 expression was induced by P.sojae in OE-GmTNL16.2 transgenic hairy roots(Fig.3D).Thus,overexpression of GmTNL16 increased soybean resistance to P.sojae infection.

3.5.Silencing of gma-miR1510a/b in hairy roots increased soybean resistance to P.Sojae

Fig.2.Subcellular localization of GmTNL16.35S:GmTNL16.1-GFP4,35S::GmTNL16.2-GFP4 and 35S::GFP4(control)constructs were transformed into tobacco leaves.mCherry was used as an endoplasmic reticulum marker.Scale bars,10μm.

qRT-PCR analyses showed that transcription levels of gma-miR1510a and gma-miR1510b were significantly lower in transgenic hairy roots than in empty vector-transformed hairy roots,indicating that gma-miR1510a and gma-miR1510b had been successfully silenced in soybean hairy roots(Fig.4A and B).The transcription levels of GmTNL16 increased significantly(Fig.4C).

STTM-positive roots were inoculated with P.sojae mycelia and the lengths of lesions were measured.The lesion length of STTM transgenic hairy roots were shorter than that of control(Fig.4D).The statistics of lesion length are shown in Fig.4E.Thus,silencing of gma-miR1510 increased the expression of GmTNL16 and increased soybean resistance to P.sojae,implying that the GmTNL16/gma-miR1510 pair regulates soybean immunity to pathogen infection.

3.6.Molecular investigation of increased disease resistance in overexpressing GmTNL16 transgenic plants

To identify the downstream targets and signaling pathway of GmTNL16 during P.sojae infection,RNA sequencing of EV and OEGmTNL16 hairy roots at 0 h and 12 h after P.sojae infection was performed,yielding respectively 38,004,164 and 66,006,268 raw reads.Of these,respectively 25,264,484 and 54,545,226 were clean reads and more than 88%were successfully aligned to the soybean Williams 82 reference genome(Table S2).

A total of 10,005 DEGs were identified in the four pairwise comparisons of the RNA-seq data(Fig.5A).2474 DEGs were upregulated and 2738 DEGs were down-regulated in the 12 h-OE vs.0 h-OE(Fig.5B).The RNA-seq results were further validated by qRT-PCR(Fig.6).Consistent with the RNA-seq data,the results from the qRT-PCR showed similar expression patterns.

To identify pathways involving GmTNL16,we focused on the comparison of 12 h-OE vs.the 0 h-OE comparison.GO term enrichment showed that the DEGs were distributed among catalytic activity,binding,transcription regulator activity and metabolic process(Fig.5C;Table S3).The KEGG pathway indicated that the DEGs were significantly enriched in biosynthesis of secondary metabolites,metabolic pathways,phenylpropanoid biosynthesis,flavonoid biosynthesis,plant hormone signal transduction,flavone and flavonol biosynthesis and isoflavonoid biosynthesis(Fig.5D;Table S4).Thus,genes related to plant hormone signal transduction and biosynthesis of secondary metabolites were highly induced in the GmTNL16 transgenic line.

3.7.SA and JA pathway were involved in resistance to P.Sojae in soybean

Phytohormones are involved in the resistance of plants to biological stress.A previous study[22]showed that there are hormone-response elements in the promoter of GmTNL16,imping a role for GmTNL16 in the hormone-mediated defense response.We accordingly measured the expression of SA and JA pathwayrelated genes in RNA-seq data.

In our study,five JAZ genes including GmJAZ1,GmJAZ12,GmJAZ14,GmJAZ22,and GmJAZ23 identified in DEGs were downregulated and COI1 was up-regulated.In the SA synthesis pathway,TGA targets SARD1 to promote SA biosynthesis.All DEGs of TGA and PR1 in the SA pathway were significantly up-regulated(Fig.7;Table S5).Thus,GmTNL16 may function in plant disease resistance by regulating the JA and SA signaling pathways.

Fig.4.Silencing miR1510 increased resistance to P.sojae.(A)The expression levels of gma-miR1510a in STTM1510a and STTM1510ab transgenic hairy roots were determined by stem-loop qPCR using GmSnoR I as the internal control.(B)Stem-loop qPCR was performed to monitor the abundances of gma-miR1510b in STTM1510b and STTM1510ab,and the values were normalized to GmSnoR I.(C)Transcript analysis of GmTNL16 determined by qRT-PCR using GmCons 4 as internal control.(D)Disease symptoms on hairy roots of STTM1510 and EV infected with P.sojae at 24 h and 36 h.1,EV;2,STTM1510a;3,STTM1510ab;4,STTM1510b.(E)The lesion lengths in STTM1510 and EV were determined at 24 and 36 hpi with P.sojae.The experiments were repeated three times.Asterisks indicate statistically significant differences(**,P＜0.01;***,P＜0.001).

4.Discussion

4.1.Characterizing GmTNL16 as a positive regulator of P.Sojae stress

TIR-NBS-LRR(TNL)genes can regulate resistance to pathogens in plants,such as tobacco N’s TIR domain is necessary and sufficient for association with p50 to confers resistance to tobacco mosaic virus[24].Overexpression of the RPP1A TIR-NB-ARC domains in Arabidopsis resulted in broad-spectrum resistance to virulent strains of H.parasitica and Pseudomonas syringae DC3000[25].GmKR3,also belonging to TNL gene,increased resistance to multiple viruses in soybean[26].In the present study,GmTNL16,a typical TNL gene,was cloned for the first time and increased resistance to P.sojae in soybean.

The expression of the R gene in plants needs to be tightly controlled to avoid autoimmunity and affect crop growth in the absence of pathogenic infection.Hairy roots of OE-GmTNL16 grew slowly compared with the control,with OE-GmTNL16.1 showing almost no growth.Similarly,overexpression of the NBS-LRR gene ADR1 in Arabidopsis resulted in elevated resistance against Peronospora parastica as well as a fitness penalty[27].Thus,we speculate that the reason why the hairy roots of OE-GmTNL16.1 did not grow maybe due to the overexpression of GmTNL16.1.Balancing disease resistance and yield in crop breeding has always been a great challenge.However,a recent study[18]showed that miR1885 dynamically regulates plant immunity and development by targeting R genes and developmental associated genes via different mechanisms.miR156-IPA1 increased disease resistance against bacterial blight and substantially increased yield potential in rice[28].These findings reflect the complex mechanism in the interaction between plants and pathogens.

4.2.miR1510 negatively regulates soybean immune response to P.Sojae infection by suppressing the expression of GmTNL16

miR1510 is specific to Phaseoleae species and targets 111 NBSLRRs,including 86 TNLs and 25 CNLs in soybean.High levels of abundance of both miRNA-5p and miRNA-3p were detected in miR1510,with the former predicted to target a variety of protein-encoding genes and the latter regulating mainly the NBSLRR gene family[29].In agreement with these reports,we observed that GmTNL16 is the target of miR1510a-3p and miR1510b-3p.

It has been shown that many 22 nt miRNAs,such as miR482/2118,miR1507 and miR825,are capable of producing phasiRNA.NBS-LRR genes can be targeted redundantly by both miRNA and phasiRNA[30].In soybean,five miRNAs,including gmamiR1510,can trigger their targets to produce phasiRNA[31].In this study,GmTNL16 is an NBS-LRR type gene,whether gma-miR1510 can generate phasiRNA to target GmTNL16 needs further research.

4.3.Involvement of JA and SA in GmTNL16-mediated P.Sojae resistance in soybean

It is well known that the SA-mediated signaling pathway provides resistance to biotrophic pathogens,whereas the JA-mediated pathway protects the plant from necrotrophic pathogens.In our study,GmTNL16 was induced by SA and MeJA treatment and the expression of genes in both the JA and SA pathways was up-regulated after inoculation.Prior to our study,knocking out OsMPK15 activated the SA and JA pathways in rice,in keeping with our results[32].This may be due to low concentrations of SA and JA can appear to be synergistically expressed[33].The JA-pathway gene GmCOI1(Glyma.11G227300),has been shown[34]to mediate JA-regulated plant defense and fertility in Arabidopsis thaliana.The expression of PR1 can be induced by mitogen activated protein kinases to increase defense response to Heterodera glycines[35].Thus,GmTNL16 may involve in the regulation of SA and JA signaling pathway in response to P.sojae infection,although the internal mechanism is still ambiguous.

Fig.5.Biological function analysis of differentially expressed genes(DEGs).(A)Venn diagram shows the numbers of DEGs overlapping between the four comparisons.(B)The numbers of DEGs identified from the four comparisons.Up-and down-regulated DEGs are shown in pink and blue,respectively.(C)GO classification of DEGs in group 12 h-OE vs.0 h-OE.The DEGs are summarized in three main categories:biological process(BP),cellular component(CC)and molecular function(MF).The X-axis indicates the number of genes and Y-axis indicates the GO terms.(D)KEGG pathway enrichment analysis between 12 h-OE and 0 h-OE comparison.Rich factor refers to the ratio of the number of transcripts in the pathway entry in the differentially expressed transcripts to the total number of transcripts in the transcripts located in the pathway entry.Dot size indicates the number of DEGs of the pathway and dot color indicates P-value.

4.4.The GmTNL16/gma-miR1510 pair acts as a molecular rheostat in response to P.Sojae infection

Comparative transcriptome analysis of EV and OE-GmTNL16 after infection revealed that 5212 genes were differentially expressed in OE,but 8489 in EV.This finding supports a previous finding[36]that the infection impact on the global gene expression profile of both susceptible and resistant cultivars,but the magnitude of the impact is higher in susceptible cultivars.Receptorlike kinases(RLKs)function in pathogen defense.The results showed that the expression of RLKs were significantly upregulated after inoculation.In plant disease resistance,secondary metabolites can be used as biochemical barriers to resist pathogen infection[37].DEGs involved in effector-triggered immunity were up-regulated in 12 h-OE,including kinase,oxidoreductase,and disease-related protein(Fig.S3A).DEGs encoding disease response proteins,such as cytochrome P450,oxidoreductase,chitinase,and peroxidase superfamily protein were also increased in 12 h-OE(Fig.S3B).

As many as 380 transcription factors(TFs)have been identified in OE,including ERF,NAC,MYB and WRKY(Fig.S3C;Table S6).MYB TFs are involved in plant defense response.Expression of GmMYB84(Glyma.05G234600)was significantly increased in 12 h-OE.RcMYB84 activates the defense responses of rose to Botrytis cinerea[38].The WRKY TFs family are plant-specific and control several types of plant stress response.The expression levels of

GmWRKY8(Glyma.19G217000),GmWRKY41(Glyma.03G220100),and GmWRKY64(Glyma.18G238600)were increased after inoculation of P.sojae in overexpressing plants and these WRKY genes can interact with pathogens in tomato[39],Arabidopsis[40]and chickpea[41]respectively.The increased activity of these upregulated TFs suggested that they regulate P.sojae infection via a variety of cis-acting sequences.

Fig.6.qRT-PCR validation of RNA-seq data.Right ordinate(in blue)represents the relative expression level of qRT-PCR.Left ordinate(in red)represents FPKM.Values are represented as mean±SD for three biological replicates.

Fig.7.JA and SA signaling pathway patterns.Red represents the expression of up-regulated genes and blue represents the expression of down-regulated genes.

We propose(Fig.8)a model of the mechanism by which GmTNL16 confers soybean resistance to P.sojae infection.Cui et al.[22]showed that under P.sojae stress,transcription of miR1510 decreased and that of GmTNL16 increased.Overexpression of GmTNL16 may promote the expression of RLKs and TFs and affect the SA and JA signaling pathways,increasing the expression of numerous defense-associated genes and affecting secondary metabolic pathways to increase resistance to P.sojae.

Fig.8.A proposed model regulatory network associated with the GmTNL16/gmamiR1510 pair in soybean.Under P.sojae stress,transcriptional of GmTNL16 increases.This may increase the transcription of RLKs and TFs and affect the SA and JA signaling pathways.The up-regulated genes then increase the transcription of defense-associated genes directly or indirectly and activate secondary metabolic pathways in response to P.sojae infection.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Li Zhou:Conceptualization,Investigation,Formal analysis,Writing-original draft,Writing-review&editing.Sushuang Deng:Investigation,Formal analysis.Huidong Xuan:Formal analysis.Xingxing Fan:Investigation.Ruidong Sun:Formal analysis.Jinming Zhao:Conceptualization,Funding acquisition,Project administration.Haitang Wang:Investigation.Na Guo:Conceptualization,Writing-review & editing,Funding acquisition,Project administration.Han Xing:Conceptualization,Writing-review & editing,Funding acquisition,Project administration.

Acknowledgments

We thank Prof.Yuanchao Wang(Nanjing Agricultural University)for providing P.sojae isolate P6497 and Prof.Dongdong Niu for providing the pFGC5941 vector.This work was supported by Jiangsu Agriculture Science and Technology Innovation Fund(CX(20)2015),National Natural Science Foundation of China(32072082,31301340),China Agriculture Research System of MOF and MARA,Program for Changjiang Scholars and Innovative Research Team in University(PCSIRT_17R55),Jiangsu Collaborative Innovation Center for Modern Crop Production and Cyrus Tang Innovation Center for Seed Industry.

Appendix A.Supplementary data

Supplementary data for this article can be found online at https://doi.org/10.1016/j.cj.2022.03.003.