Evaluation of host resistance and fungicide application as tools for the management of root rot of field pea caused by Aphanomyces euteiches

Longfei Wu,Kn-F Chng,Sheu-Fng Hwng,*,Roert Conner,Rudolph Fredu-Agyemn,Dvid Feindel,Stephen E.Strelkov,*

aDepartment of Agricultural,Food and Nutritional Science,University of Alberta,Edmonton,AB T6G 2P5,Canada

bCrop Diversification Centre North,Alberta Agriculture and Forestry,Edmonton,AB T5Y 6H3,Canada

cAgriculture and Agri-Food Canada,Morden Research and Development Centre,Morden,Manitoba R6M 1Y5,Canada

Keywords:Aphanomyces euteiches Field pea Fungicides Inoculum density Resistance

ABSTRACT Aphanomyces root rot(ARR)of field pea(Pisum sativum),caused by Aphanomyces euteiches,can cause severe root damage,wilting,and large yield losses under wet soil conditions.To identify ways to manage this disease,the effect of A.euteiches inoculum density on field pea was studied under greenhouse and field conditions in 2015 and 2016.Increases in inoculum density reduced seedling emergence,root nodulation,and plant vigor,and resulted in increased root rot severity in both field and greenhouse tests.Seed treatments with the fungicides Apron Advance(thiabendazole+fludioxonil+metalaxyl)+Vibrance(difenoconazole+metalaxyl-M+sedaxane),INTEGO Solo(ethaboxam),BAS 516F(boscalid+pyraclostrobin),BAS 720F(metalaxyl+pyraclostrobin+fluxapyroxad),andBAS516F+BAS720F(3:1)were evaluated for their efficacy against ARR.All seed treatments except Apron Advance+Vibrance reduced root rot severity under controlled conditions.BAS 516F,BAS 720F and INTEGO Solo improved plant vigor and all treatments reduced seedling blight to varying degrees under greenhouse conditions,but not in the field.A collection of 22 pea genotypes was evaluated for resistance to root rot in field plot experiments.Line 00-2067 showed the least severe root rot symptoms,whereas‘Spring D'showed the lowest reduction in yield.The results suggest that there may be an opportunity to combine partial host resistance and fungicidal seed treatments to adequately manage ARR of field pea.

1.Introduction

Field pea is a valuable cash crop,owing to its high protein content and ability to improve soil fertility[1].It is widely cultivated for human and livestock consumption.Canada is the largest producer and exporter of field pea worldwide[2].Cultivation is affected by the oomycete Aphanomyces euteiches,which is one of the most destructive soilborne pathogens of legume crops.It has been reported from most regions where field peas are cultivated,including North America,Europe,Japan,Australia,and New Zealand[3-5],and can cause yield losses as high as 86%[6].Recently,A.euteiches was recorded for the first time in Alberta,Canada,where it was identified in seven fields within a 200-km radius in the southern part of the province[7].Itsrelatively wide distribution led to the suggestion that A.euteiches likely had been present in Alberta for some years[7],a suggestion that was supported by the results of a root rot survey that found A.euteiches to be the third most commonly recovered pathogen after Fusarium spp.and Pythium spp.[8].

Outbreaks of Aphanomyces root rot(ARR)require high soil moisture,and favorable temperatures are between 16 and 18°C[9].The pathogen can infect leguminous hosts at any stage of plant development,resulting in diverse symptoms[10].If infection occurs at early growth stages,the roots of affected seedlings become soft and water-soaked with a honey-brown to blackish-brown discoloration.The pathogen spreads intercellularly through the cortical tissue and destroys the rootlets.Cortical decay of the lateral roots develops,limiting nutrient and water uptake from the soil[9].Eventually,the plants wilt,causing premature death and yield losses.

There are very few methods available for the management of ARR in field pea.The thick-walled oospores can persist in the soil for＞10 years,so that the recommended length of rotation between host and non-host crops is more than six years[1].Although diversification of the cropping sequence can be an effective long-term strategy for management of ARR[11],the length of the rotations necessary may be unacceptable to most farmers.

Seed treatments have been evaluated to improve seedling emergence.For example,pea seeds treated with a combination of the biocontrol agent Clonostachys rosea(Link)Schroers strain ACM941 and several common fungicides showed better germination rates than those coated only with fungicides[12].Seed treatment with the fungicide Fosetyl-Al(aluminum tris)resulted in effective control of root rot caused by A.euteiches under greenhouse conditions[13].The coating of seeds with arbuscular mycorrhizal fungi also has been shown to increase pea seed emergence following inoculation with A.euteiches in greenhouse experiments[14,15].In Canada,INTEGO Solo(ethaboxam)seed treatment is registered in legumes for control of Pythium and suppression of early season rot caused by Phytophthora and Aphanomyces,and is the only product available with activity against A.euteiches.More effective fungicidal or biological seed treatments for Aphanomyces control are still needed in western Canada.

Genetic resistance may offer an economic way of controlling A.euteiches,but completely resistant cultivars of field pea have not been identified[16].Shehata et al.[17]and Malvick and Percich[18]reported tolerance to ARR in several plant introduction(PI)lines of pea.The pea line 00-2067 was tolerant to ARR,with higher yields than other genotypes in soil infested with A.euteiches[19].Tolerant pea lines were reported to have smaller root lesions and to produce fewer oospores in infected roots of pea seedlings eight days after zoospore inoculation than susceptible cultivars in a greenhouse experiment[20].According to Wicker et al.[21],partial resistance also occurs in the pea genotypes MN313 and PI 180693,among others.Marx et al.[22]showed that the tolerance to ARR is a genetic trait,and several genetic mapping studies[23-26]have identified quantitative trait loci(QTL)that are linked to resistance in field pea.

The objectives of this study were to(1)examine the effect of inoculum density on the incidence and severity of ARR in field pea,(2)evaluate the efficacy of several new seed treatments on seedling emergence and plant health,and(3)evaluate the tolerance of some pea cultivars to A.euteiches isolates collected in western Canada.

2.Materials and methods

2.1.Preparation of inoculum

An isolate of A.euteiches,Ae-MRDC1,was obtained from pea roots grown in A.euteiches-infested field soil.The isolation and purification of Ae-MRDC1 followed Wicker et al.[21].Briefly,infected root tips from the soil samples were surfacesterilized in a 1%NaClO solution for 30 s,rinsed in sterilized water three times,and placed on metalaxyl-benomylvancomycin(MBV)medium[27].After two days,colonies with the morphological characteristics of A.euteiches described in the keys of Dick[28]and Scott[29]were selected and transferred onto water agar medium for another two days.Single hyphal tips were cut from selected colonies under a stereomicroscope and transferred onto potato dextrose agar(PDA)for preservation.The disease severity indices caused by Ae-MRDC1 were＞1 on each of the differential pea genotypes of Wicker and Rouxel[5](‘Baccara'=2.3, ‘Capella'=1.9,‘MN313'=2.7, ‘902131'=2.9, ‘552'=2.8,and ‘PI180693'=1.5)and Ae-MRDC1 was accordingly classified as virulence pathotype I as defined by Wicker and Rouxel[5].

The identity of Ae-MRDC1 and a culture of this isolate reisolated from inoculated pea roots was confirmed by PCR analysis as A.euteiches.Briefly,total genomic DNA of the isolate was extracted according to Vandemark et al.[30]and the primers 136 Forward(5′GACTGCAATGTCGTCCAAGACTT 3′)and 211 Reverse(3′AGCTAGAAGTAGAGTCGAAACA 5′)were used to amplify a 76-bp fragment specific to A.euteiches[30,31].Amplification conditions consisted of 40 cycles of denaturation at 94 °C for 30 s,annealing at 56 °C for 45 s,and extension at 72°C for 45 s.The products were resolved on a 1.5%agarose gel by electrophoresis for 1.5 h at 100 V[30].

Sand-oat-based inoculum(sand 98 mL,oats 2 mL,and water13 mL)of A.euteiches was applied in fieldand greenhouse tests according to the modified protocol described by Papavizas and Ayers[9].Briefly,rolled oats(500 mL sand,150 g oats,and 100 mL water per bag)were autoclaved and then inoculated with oospores of A.euteiches,followed by incubation for four weeks in the dark at 25°C.The grain inoculum was dried at room temperature and ground in a blender.To assess the viability of the sand-oat inoculum,serial dilutions were made with distilled water and the number of colony-forming units(CFUs)per gram of inoculum in the diluted samples was assessed on a selective medium(MBV agar)[27].The concentration of the inoculum was adjusted to 1×105CFU g-1with sterile sand.

2.2.Plant materials

Seed of 22 field pea cultivars commonly grown in central Alberta was purchased from seed growers.The cultivar selection was based on the results of a seed infection test for susceptibility to A.euteiches pathotype I.Seeds were surfacesterilized in a 2%NaClO solution for 3 min and then rinsed three times in sterilized water.Five seeds of each cultivar were placed in 9 cm-diameter Petri dishes filled with 20 mL PDA medium,on which four agar blocks colonized by A.euteiches for 7-10 days also had been placed.The Petri dishes were incubated at 16°C in the dark.After seven days,the number of seeds that had germinated and still had healthy roots was recorded.The experiment was repeated once.The two pea cultivars with the lowest germination rates,‘Abarth'and‘Horizon',were selected as susceptible cultivars for the field and greenhouse experiments.

2.3.Field preparation

Field trials were conducted in four site-years(two sites for each year)at the Crop Diversification Center North(CDCN),Alberta Agriculture and Forestry,Edmonton,AB(latitude 53°34′N,longitude 113°31′W),in 2015 and 2016.Another field trial was conducted at the Agriculture and Agri-Food Canada(AAFC)Morden Research and Development Centre,Morden,MB(latitude 49°11′N,longitude 98°5′W)in 2016.All field sites were located on a black,chernozemic sandy loam soil.Prior to use as a plot area,the Edmonton sites had been in canola(Brassica napus L.)in 2014 and wheat(Triticum aestivum L.)in 2015.Because fieldpea had been grown continuously in monoculture at the Morden site for the past 20 years,ARR disease pressure was known to be high[19].Pursuit(BASF Canada,Mississauga,ON)alone or in tank mix with Basagram(BASF Canada)and Assure II(DuPont Canada,Mississauga,ON)was used for postemergent weed control as per label instructions.

2.4.Disease rating

Plants were uprooted from the soil 3-4 weeks after seeding in greenhouse studies and 3 months after seeding in field trials.The root samples were washed with tap water and examined for symptoms of root rot.The roots of each plant were rated on the disease severity scale of Papavizas and Ayers[9],where 0=healthy roots with no visible symptoms of root rot;1=slight water-soaking of the primary or secondary roots(1%-25%discoloration);2=moderate water-soaking of the primary or secondary roots or epicotyls with light-brown areas and more extensive(26%-50%)discoloration;3=infected areasextensive,soft,but the entire root is not collapsed and the epicotyl is not markedly shriveled(51%-75%discoloration);4=extensive discoloration of the roots with tissue collapse and disintegration,or plant completely dead(76%-100%discoloration).A disease severity index(DSI)was calculated by averaging the root rot severity of each experimental unit[9].

2.5.Inoculum density experiments

Field plots,each consisting of four 6 m-long rows spaced 40 cm apart,were established on June 15,2015 and May 17,2016 in previously tilled areas at the two sites in Edmonton,AB to determine the effect of inoculum density on seedling growth and productivity.Eighty seeds of ‘Abarth'and ‘Horizon'were sown per row at a depth of 5 cm with a push seeder using 150 mL sand inoculum row-1mixed with the seed,along with a commercial rhizobial inoculant(Rhizobium leguminosarum biovar viciae,granular formulation,Cell-Tech,Monsanto,Winnipeg,MB,10 mL per 6-m row).Four concentrations of A.euteiches graininoculum(0,80,160,and 240 CFU mL-1)were applied.The trial was arranged in a randomized complete block design(RCBD)with four replications,with fixed effects being cultivar and inoculum concentration.Emergence counts and seedling vigor(0-4,where 0=completely healthy;1=slightly wilted;2=moderately wilted;3=severely wilted;4=completely wilted,plant dead)were recorded at 2 and 4 weeks after seeding,respectively,following Chang et al.[32].Emergence was calculated as(seedling number in each pot/10)×100%.Three months after seeding,root rot severity and root nodulation were recorded for 10 randomly selected plants from each plot.Nodulation was evaluated on a 0-4 scale as described by Chang et al.[32].The plots were harvested on September 29,2015 and September 7,2016 and the seeds from each plot were air-dried,cleaned,and weighed to determine yield.

In a greenhouse experiment,the pea cultivars‘Abarth'and‘Horizon'were sown in 600-mL plastic cups containing 400 mL of a steam-pasteurized potting mixture consisting of loam,sand,and vermiculite(3:1:1,v:v:v),100 mLA.euteiches inoculum,and 1 mL R.leguminosarum.The cups were maintained in a greenhouse at 26-28°C with a 12 h photoperiod and were placed in trays filled with water to ensure high moisture levels in the potting mixture.Ten seeds per cup(9 cm in diameter and 10.5 cm depth)were planted at a depth of 2 cm,and the sand-oat inoculum included 10 different concentrations of A.euteiches(2.8,5.6,11.3,22.5,45,90,180,360,720 CFU mL-1,and a pathogen-free control).The cups were arranged in a two-factor RCBD with six replications(cups)per treatment,with the two fixed effects being cultivar and inoculum concentration.The emergence,height,and degree of vigor(0-4)of the seedlings were assessed at 14 days after seeding.The plants in each cup were uprooted four weeks after seeding and root rot severity and nodulation were evaluated as previously described.The experiment was conducted twice.

2.6.Fungicide seed treatment experiments

Field experiments were established on June 15,2015 and May 17,2016 at two sites at Edmonton and on May 11,2016 at one site at Morden to evaluate the efficacy of five seed-treatment fungicide formulations: Apron Advance (thiabendazole + fludioxonil + metalaxyl) + Vibrance (difenoconazole + metalaxyl-M + sedaxane), INTEGO Solo (ethaboxam), BAS 516F (boscalid + pyraclostrobin), BAS 720F (metalaxyl + pyraclostrobin + fluxapyroxad) and BAS 516F + BAS 720F(1:3).The experiments were arranged in a one-factor RCBD with four replications.The seed treatments were applied uniformly to pea seeds of the susceptible‘Horizon'at the manufacturers' recommended rates(Table 1).In Edmonton,two fungicide-free controls also were planted in A.euteichesnon-inoculated and A.euteiches-inoculated plots.Eighty seedswere sown at a depth of 5 cm along with 150 mL sand-oat inoculum(350 CFU mL-1)per 6-m row spaced 40 cm apart(2.1×105CFU plot-1).At Morden,seeds treated with the five fungicides and one fungicide-free control were sown in a field naturally infested with A.euteiches.The four row plots were trimmed to 5 m in length with 0.6 m spacing between the rows.Emergence,root rot severity,vigor,and nodulation rates were recorded as in the inoculum density experiment.The pea plants in each field plot were hand-harvested on September 29,2015 and September 7,2016 at Edmonton and on August 15,2016 at Morden.After drying,the material from each plot was threshed with a small-plot combine.The seeds were cleaned with a Clipper seed cleaner(A.T.Ferrell Co.,Bluffton,IN,USA)and weighed to determine yield.

Table 1-Rates of five fungicide seed treatments on two field pea cultivars, ‘Abarth’and ‘Horizon’,susceptible to Aphanomyces euteiches.

In greenhouse experiments,the two susceptible pea cultivars ‘Horizon' and ‘Abarth' were treated with the same fungicides as above to assess their efficacy against ARR.The plants were grown in 600 mL plastic cups as described previously,at a density of 10 seeds per cup.The A.euteiches inoculum concentration was 350 CFU mL-1(2.1×105CFU cup-1).The treatments were arranged in a two-factor RCBD with six replications(cups)per treatment,with cultivar and seed treatment as fixed effects.The entire experiment was repeated once.Emergence,plant height and seedling vigor,root rot severity,and nodulation were recorded as previously described.

Fig.1-Effect of Aphanomyces euteiches inoculum concentration on disease severity(a),emergence rate(b),degree of wilt(vigor)(c)and yield(d)of two susceptible field pea cultivars,‘Abarth’and ‘Horizon’,under field conditions in Edmonton,AB,in 2015-2016.

Fig.2-Effect of Aphanomyces euteiches inoculum concentration on disease severity(a)and plant height(b)in field pea.The relationships between nodulation and inoculum concentration(c)and nodulation and root rot severity(d)also are shown.The plots of four replicates describe the greenhouse data obtained with the susceptible field pea cultivars ‘Abarth’and ‘Horizon’.

2.7.Evaluation of host resistance

A total of 22 field pea genotypes were evaluated for their response to A.euteiches under field conditions at the Edmonton sites in 2015 and 2016.Treatments were arranged in a randomized split-plot design with four replications,in which the main plots were inoculated or non-inoculated and the subplots comprised different pea genotypes.The 80 seeds were sown in four 6-m rows spaced 40 cm apart at a depth of 5 cm in each plot on May 12,2015 and May 4,2016.Sand-oat based inoculum of A.euteiches(350 CFU mL-1)was applied with the seeds at a rate of 150 mL per 6-m row.Emergence,root rot severity,vigor,nodulation,and yield were measured as described above for the inoculum density test.The plots were harvested by small-plot combine on September 23,2015and September 8-9,2016 and seed was air-dried,cleaned,and weighed to determine yield.

Table 2-The effect of fungicide seed treatments on a susceptible field pea cultivar, ‘Horizon’,grown in soil infested with Aphanomyces euteiches(Aphanomyces root rot)under field conditions at Edmonton,AB,in 2015-2016a.

Table 3-The effect of fungicide seed treatments on a susceptible field pea cultivar,‘Horizon’,grown in soil infested with Aphanomyces euteiches(Aphanomyces root rot)under field conditions at Morden,MB,in 2016a.

2.8.Statistical analysis

All statistical analyses were conducted using R 3.2.3 software[33].Data were tested for normality using the Lilliefors(Kolmogorov-Smirnov)normality test,and Bartlett's test was used to assess the homogeneity of variance among trials.Least-squares means were compared using least significant differences(LSD)at P＜0.05.In field experiments,the data from the inoculum density test,seed treatment test and resistant cultivar evaluation were analyzed separately by year because the year×treatment interactions were significant(P＜0.05).In greenhouse experiments,where repetition×treatment was not significant,the data were pooled across repetitions for the analysis.Regression analysis was performed to determine the relationship of inoculum density with root rot severity,plant height,root nodulation,degree of wilting(vigor),and emergence in the greenhouse.In the inoculum density study in the field and greenhouse and the seed treatment study in the greenhouse,the differencebetween the two susceptible pea cultivars was not significant(P＜0.05).Accordingly,data from those cultivars were pooled.

Table 4-The effects of fungicide seed treatments on two susceptible field pea cultivars, ‘Abarth’and ‘Horizon’,inoculated with Aphanomyces euteiches(Aphanomyces root rot)under greenhouse conditionsa.

A mixed analysis of variance(ANOVA)model was used to analyze the data from the field trials,using inoculum concentrations in the inoculum density test,fungicides in the seed treatment trial,and pea genotypes in the resistance evaluation test as fixed factors,while years,sites,and blocks were treated as random factors.Least significant difference comparisons were used to determine whether the analyzed traits differed among treatments.When the results of the ANOVA were significant(P＜0.01),regression analyses were performed to examine the relationships among the treatments and host genotypes.Pearson correlation coefficients among the parameters in the seed treatment study in the greenhouse were calculated.A genotype plus genotype-byenvironment(GGE)biplot analysis[34]was performed to investigate the stability of resistance to A.euteiches and the yield performance of the pea genotypes over the field trials.

3.Results

3.1.Inoculum density

Rainfall in 2015 was the lowest in the preceding five years with major showers occurring only in mid-June,July,and September(data not shown).Frequent,and sometimes heavy,rainfall events occurred throughout the growing season in2016.As a result,weather conditions were more conducive for ARR development in 2016 than in 2015.The year×treatment interaction was significant. Accordingly, the data were analyzed separately by year for all of the field trials. The values for disease severity,emergence,vigor,and yield were consistently greater in 2016 than in 2015 across all inoculum concentrations(Fig.1).Under field conditions,all of the inoculated treatments showed higher ARR severity and significantly lower pea seedling emergence,vigor,and yield than the non-inoculated control(Fig.1).Emergence and seedling vigor decreased with increased inoculum concentration.A linear relationship was observed between inoculum concentration and root rot severity,emergence,vigor,and yield in both 2015 and 2016(Fig.1).

Table 5-Pearson correlation coefficients between plant height,Aphanomyces root rot severity,root nodulation and vigor in two susceptible field pea cultivars,‘Abarth’and ‘Horizon’,inoculated with Aphanomyces euteiches under greenhouse conditions.

Table 6-Seedling emergence,vigor,Aphanomyces root rot severity,nodulation,and yield in 22 pea genotypes grown in Aphanomyces euteiches-infested field plots in Edmonton,AB,in 2015 and 2016.

In the greenhouse tests,the effects of inoculum concentration on plant height,root rot severity,and root nodulation were significant(P＜0.05).As the inoculum density increased,pea root rot became more severe,resulting in reduced plant height and root nodulation(Fig.2-a,b,and c).Disease severity showed the highest rate of increase(300%)at the concentration of 3.8 ln of CFU mL-1.The logarithmic linear regression model describing the dependence of root rot severity on inoculum concentration was y=0.80 ln(x)-0.99,R2=0.91(Fig.2-a).For that relating inoculum concentration to plant height,the equation was y=-2.67 ln(x)2+14.02 ln(x)+89.67,R2=0.97(Fig.2-b),whereas for inoculum concentration and root nodulation,it was y=-0.45 ln(x)+2.79,R2=0.90(Fig.2-c).The Pearson correlation between root rot severity and nodulation was negative(Fig.2-d).A linear regression model expressing nodulation as a function of disease severity was y=-0.56x+2.22(R2=0.97).

3.2.Fungicide seed treatment

In the field experiment at all sites in both 2015 and 2016,symptoms of root rot appeared as a brown discoloration of the roots four weeks after seeding.None of the treatments,however,significantly improved seedling vigor and yield,or reduced disease severity,compared with the inoculated control at either Edmonton or Morden(Tables 2 and 3).Compared with the inoculated control,the fungicide treatment Apron Advance+Vi brance significantly increased root nodulation in 2015 at both of the Edmonton sites,compared with all other treatments except INTEGO Solo and BAS 720F,but none of the fungicide effects were significantly different from the inoculated control at any of the sites in 2016.

In the greenhouse study,the differences between inoculated and non-inoculated controls for plant height,disease severity,root nodulation,and vigor were significant(Table 4).Disease severity was correlated negatively with plant height,root nodulation,and vigor(Table 5).Three of the fungicide treatments,INTEGO Solo,BAS 516F and BAS 720F,increased root nodulation and vigor,and reduced disease severity significantly,compared with the inoculated control(P＜0.05)(Table 4).INTEGO Solo and BAS 516F also increased plant height significantly(P＜0.05).Seed treatment with INTEGO Solo resulted in the numerically greatest mean height,vigor,and nodulation,whereas seed treatment with BAS 720 resulted in the lowest numeric disease severity.

3.3.Partial resistance or tolerance to ARR

Fig.3-A GGE biplot showing rankings with respect to increase in Aphanomyces root rot severity in 22 pea cultivars/lines in relation to that of a cultivar with leastvariance.Values are expressed as the quotient of the disease severity of the plots inoculated with Aphanomyces euteiches divided by that in the non-inoculated plots under field conditions in Edmonton,AB,in 2015 and 2016.

Fig.4-A GGE biplot showing rankings with respect to percentage yield reduction caused by Aphanomyces euteiches in 22 pea cultivars/lines in relation to that of a cultivar with least variance.Values are expressed as the quotient of the yield of plots inoculated with A.euteiches divided by that in the non-inoculated plots under field conditions in Edmonton,AB,in 2015 and 2016.

Emergence,root rot severity,nodulation and vigor were significantly different(P＜0.05)for all the pea genotypes examined in 2016,and significant differences were found between inoculated and non-inoculated plots for each factor.In 2015,none of the parameters within the inoculated and non-inoculated plots were significant(Table 6).The cultivar‘Golden'showed the highest emergence in the inoculated plots in 2015,while‘Reward'showed the highest emergence in 2016.In the inoculated plots,the lowest disease severity was observed in‘Carman'in 2015 at both sites,while the lowest disease severity was observed in line 00-2067 in 2016.The highest root nodulation was observed in‘Cooper'and‘LN4228'in inoculated plots in 2015 and 2016,respectively.Plant vigor in the field was greatest for‘Carman'in 2015,while in 2016 vigor was the highest in ‘Cooper', ‘Hornet', ‘LN4228',and ‘Reward'.The cultivar ‘Leroy'showed the greatest yield in both non-inoculated plots and inoculated plots in 2015,while in 2016,‘Saffron'showed the greatest yields in the inoculated plots and ‘Saffron'and ‘LN4228'showed the greatest yield in the non-inoculated plots.The GGE biplot analysis indicated that line 00-2067 was the most resistant host genotype,while‘Spring D'had the lowest percentage yield reduction(Figs.3 and 4).

4.Discussion

In greenhouse tests,inoculation of pea with A.euteiches virulence pathotype I reduced plant height,nodule numbers and vigor at the seedling stage.Root rot severity increased by＞300%at 3.8 ln of CFU mL-1(the greatest increase among the 10 inoculum concentrations evaluated).This finding suggests that outbreaks of ARR may require a threshold level of pathogen inoculum in the soil.

Cannesan et al.[35]observed that infection by A.euteiches starts in the elongation zone of the pea roots,which is the region that stimulates root cell elongation.Cannesan et al.[35]also indicated that stimulation by A.euteiches of bordercell production is dependent on the number of oospores.Based on the results of the inoculum density test,however,when the number of oospores in the soil was large,the negative impact of infection was more substantial.A negative linear relationship was observed between root nodulation and root rot severity,indicating that A.euteiches infection suppresses root nodule number.The suppression of nodule formation also was observed for pea root rot caused by Rhizoctonia solaniKühn [36].The mechanisms remain unknown.

Under greenhouse conditions,disease severity was negatively correlated with plant height,nodulation,and vigor,again illustrating the adverse effects of A.euteiches on plant health.Apron Advance+Vibrance did not increase plant health under ARR disease pressure.Seed treatment with the three other fungicides,especially INTEGO Solo,suppressed disease severity under controlled conditions.In contrast,under field conditions,none of the fungicides tested had a significant effect on ARR severity at the seedling stage,a finding that may reflect complex soil conditions,the presence of other soilborne pathogens,or the degradation of the fungicidal seed treatments.Oyarzun et al.[13]reported that a single fungicide(fosetyl-Al)was sufficient to control ARR in the greenhouse but not under field conditions,owing to interaction with other pathogens of the root rot complex.In a field study by Xue[12],the biological control agent C.rosea strain ACM941 provided control of ARR in some years,but not others.Thus,it appears that a single fungicide or product on its own cannot provide acceptable control of the root rot complex in field pea under field conditions.Seed treatments formulated with different fungicides and/or biological control agents compatible with fungicides should be evaluated in the future.

In the present evaluation of resistance in field pea to A.euteiches,differences between inoculated and non-inoculated sites for all of the parameters were significant in 2016,but not in 2015.This finding may be explained by the intense rainfall that occurred in 2016,which favored the development of ARR.All the traits measured varied significantly among the 22 pea cultivars in the field trials at Edmonton between 2015 and 2016.The cultivars ‘Leroy'and ‘Saffron'showed the highest yields in the inoculated plots in 2015 and 2016,respectively.Nonetheless,the GGE biplot analysis showed that‘Spring D',showing the lowest percentage yield reduction,was the most stable entry for that trait,indicating the highest tolerance to ARR pressure.A similar analysis showed that line 00-2067 was the genotype most resistant to ARR,with the lowest disease severity and lowest increase in disease severity between inoculated and non-inoculated sites.This finding is consistent with the prior findings of Conner et al.[19].Based on the performance of the 22 field pea cultivars evaluated,it seems that “ideal”cultivars that combine high yielding potential with partial resistance(or tolerance)to A.euteiches are not available in Alberta.Breeding efforts aimed at developing field pea cultivars for western Canada that have effective ARR resistance or tolerance and good agronomic traits should be a priority.It is likely,however,that no single ARR management strategy will be sufficient to control this disease completely.An integrated approach that combines partial host resistance with seed treatments and the incorporation of cultural practices such as crop rotation will be needed for the sustainable control of ARR of field pea.

Acknowledgments

The authors thank H.Ahmed,Q.Zhou,and G.Turnbull(Alberta Agriculture and Forestry),and B.D.Gossen,W.Penner and D.Stoesz(Agriculture and Agri-Food Canada(AAFC)),for their assistance with this study.Funding support from Agriculture and Agri-Food Canada,the Saskatchewan Pulse Growers,and the Manitoba Pulse and Soybean Growers through the Growing Forward 2 Program also is gratefully acknowledged.