lntergenic spacer 1 (lGS1) polymorphism map: A marker for the initial classification of cultivated Lentinula edodes strains in China

SONG Xiao-xia, ZHAO Yan, SONG Chun-yan, Ll Chuan-hua, CHEN Ming-jie, HUANG Jian-chun, TAN Qi

Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, Shanghai 201403, P.R.China

Abstract China is currently the world’s leading producer of Lentinula edodes and owns many cultivated strains of this species. This study was performed in order to investigate intergenic spacer 1 (IGS1) polymorphism and classification among 49 popular cultivated strains. The great majority of the 49 strains possessed two different IGS1 sequences, with distinct lengths and homologies. Based on the length and homology of the IGS1 sequences of the 49 strains, the strains were classified into two groups: A and B. Group A was subdivided into six subgroups. Forty-seven strains were homozygous or heterozygous among these six subgroups in group A, Cr01 was heterozygous between A and B, and Guangxiang 9 was homozygous in group B. An IGS1 polymorphism map of each cultivated L. edodes strain is reported for the first time and could be used as a marker for the initial classification and management of cultivated L. edodes strains in China.

Keywords: Lentinula edodes, strain, intergenic spacer, polymorphism, genotype

1. lntroduction

Lentinula edodes (Berk.) Pegler belongs to Fungi, Basidiomycota,Agaricomycetes, Agaricales, Omphalotaceae, Lentinula(International Mycological Association 2017). Because of its unique taste, flavor and medicinal value, L. edodes has become popular and has been cultivated around the world(Chang and Miles 2004). China is the first country to cultivate L. edodes (Chang and Miles 1987), is an important natural genetic diversity center of L. edodes (Xu et al. 2006) and is the world’s leading producer of L. edodes (Chang and Miles 2004). More than 500 cultivated strains have been used in cultivation in China (Song et al. 2015). However,after a long period of market and manual screening, the number of widely utilized strains in cultivation is less than 100, and these strains were mainly developed from some elite and introduced strains, especially from Japan (Song et al. 2015). The widely utilized strains in cultivation have a low level of genetic diversity (Fu et al. 2010; Liu et al.2012, 2015; Li et al. 2017) and even possess different gene pools with most of the wild strains of L. edodes in China(Xiao et al. 2016).

The nuclear ribosomal internal transcribed spacer (ITS)region located in ribosomal DNA (rDNA) is a useful marker for identifying populations of L. edodes (Hibbett et al. 1995,1998; Xu et al. 2006), and this region contains three genes,ITS1, 5.8S and ITS2. Based on the ITS1/5.8S/ITS2 marker,the populations of widely utilized strains in cultivation and most wild strains in China can be easily distinguished (Song et al. 2018b). The widely utilized strains in cultivation in China belong to A/A/A1, whereas most of the wild strains in China belong to A/A/A2 and other mixed types (Song et al. 2018b). The ITS1/5.8S/ITS2 marker can be used for the initial classification of L. edodes strains in China. Two questions arise: Whether there is a marker that can be sequenced as easily as the ITS region and whose sequence can be used to classify internal cultivated strains in China?Some genes with a faster evolution than the ITS region could be used.

The intergenic spacer (IGS) is also located in rDNA and is divided into IGS1 and IGS2 by insertion of 5S rRNA sequences. IGS1 and IGS2 show a faster evolution than the ITS region and have been widely used for analyses of intraspecies diversity and for strain typing of fungi (Bunyard et al. 1996a, b; Saito et al. 2002; Sugita et al. 2002, 2003,2005; Babasaki et al. 2007; Bhardwaj et al. 2007). In L. edodes, the length of IGS2 is 2-3 kb and that of IGS1 is 0.9-1.3 kb (Saito et al. 2002). Sanger sequencing is the main method used for sequencing the ITS region. This method produces an average read length of 700 nucleotides after unidirectional sequencing (Hoff et al. 2009). After bidirectional sequencing, the complete IGS1 sequence is obtained, but the complete IGS2 sequence could not be acquired. Therefore,the internal classification of the widely utilized strains in cultivation in China can be studied by IGS1 sequences.

rDNA is a repetitive gene family and its copy number varies from 30 to 30 000 in most eukaryotes (Prokopowich et al. 2003). All rDNA repeats are organized tandemly at one or more sites per haploid genome (Ganley and Kobayashi 2007). Though the polymorphisms are detected in rDNA repeats per haploid genome, they seem to exist beneath the level of selection, and rDNA has indeed evolved via concerted evolution (Ganley and Kobayashi 2007). However, many studies have shown that rDNA is present in a wide variety of organisms with higher intra-strain and intra-species variation and may not always evolve in a strictly concerted manner(Saito et al. 2002; Simon and Wei? 2008; Chen et al. 2016).The higher intra-strain and intra-species variation of the ITS and IGS1 genes is common in L. edodes strains (Saito et al.2002; Song et al. 2018b) and most L. edodes strains in China possess two different ITS sequences that originate from their heterokaryons (Song et al. 2018b). Thus, the main objectives of this study were to investigate the IGS1 polymorphism and to study the internal classification among widely utilized strains in cultivation in China.

2. Materials and methods

2.1. Source and cultivations of cultivated strains

Forty-nine widely utilized strains of L. edodes from China were used in this study (Appendix A). These strains were obtained from professional research institutes of eight Chinese provinces and Shanghai City via the Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences,and were maintained in 9-cm Petri dishes containing potato,dextrose and agar (PDA) medium at 25°C (in the dark).Because the analysis of the IGS1 polymorphism of L808 was completed before this study (Song et al. 2018a), its two IGS1 sequences (MF177505 and MF177506) were directly incorporated into the polymorphism analysis.

2.2. DNA extraction and PCR amplification of cultivated strains

A few mycelia from each cultivar were scraped into 50 μL of dilution buffer, which is a component of the Thermo Scientific Phire Plant Direct PCR Kit (Thermo Fisher Scientific,Inc., America). The solutions were then mixed for 1 min at 1 650 r min-1using an Eppendorf MixMate (Eppendorf Aktiengesellschaft, Hamburg, German). The cell lysates were taken directly as templates for PCR amplification.

The total volume of all PCR amplification reactions was 25 μL: 1 μL of cell lysate, 12.5 μL of PCR MagicMix 3.0(Tiandz, Inc., China), 10.5 μL of sterilized ddH2O, 0.5 μL of forward primer (IGS-1-P-1: TTGCAGACGACTTGAATGG)and 0.5 μL of reverse primer (5S rDNA1.rvc: TAGGATTCCC GCGTGGTCCCCCA) (Babasaki et al. 2007). The PCR program included the following steps: 94°C for 5 min; 25 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 3 min;72°C incubation for 5 min; and 4°C held until completion. The PCR products were detected on 1.2% (w/v) agarose gels,and pictures were taken using G:BOX (Syngene, England).

2.3. lGS1 sequencing of cultivated strains

The PCR products were purified using a SanPrep Column DNA Gel Extraction Kit (Sangon Biotech (Shanghai) Co.,Ltd., China) and cloned into a pUCm-T vector using a pUCm-T Vector Cloning Kit (Sangon Biotech (Shanghai) Co.,Ltd., China). The cloned plasmids were then transformed into competent cells using an Ultra-Competent Cell Prep Kit(Sangon Biotech (Shanghai) Co., Ltd., China). Afterwards,the transformed cells were plated, and five monoclonal colonies of each cultivar were sent to Sangon Biotech(Shanghai) Co., Ltd., China, for sequencing.

The accuracy and direction of the obtained sequences were confirmed by a BLASTN search (http://blast.ncbi.nlm.nih.gov), and the primer sequences were manually removed.The identical sequences among the selected cultivars were merged using SeqMan Pro in DNAStar (Lasergene v7.1.0).Sequences with more than two varying bases (via either mutation or deletion) were deemed to be different sequences and marked as either -1, -2, or -3 depending on their repeating numbers. The sequences were then deposited into GenBank (MF541551-MF541640).

2.4. lGS1 analysis of cultivated strains

All sequences were aligned, and the bases of 28S and 5S were removed using MEGA v7.0 in accordance with the annotated information in NCBI. A maximum parsimony(MP) tree was constructed using MEGA v7.0. The number of bootstrap replications was 1 000. All sites were used for gaps/missing data treatment, and the MP search method was tree-bisection-reconnection (TBR). The length of each IGS1 sequence was obtained using the EditSeq tool in Lasergene v7.1.0. The MP tree and length of each IGS1 sequence were combined using Interactive Tree of Life (iTOL) Software (http://itol.embl.de/). All IGS1 sequences were grouped based on length and homology.The consensus sequences of each group were obtained using the SeqMan tool in Lasergene v7.1.0; tandem repeats were tested with the Tandem Repeats Finder (TRF) v4.09(http://tandem.bu.edu/trf/trf.html). The consensus sequence alignments (including all groups) were performed using DNAMAN v5.2.2.

3. Results

3.1. lGS1 polymorphism

With the exception of Cr01 and Guangxiang 9 (exhibiting two bands), 46 strains displayed only one band in an analysis using 1.2% (w/v) agarose gels (Fig. 1). Because the two bands for Cr01 and Guangxiang 9 were very close, they were mixed, purified, cloned and sequenced. Following sequencing, 34 strains were found to have two different IGS1 sequences, 10 strains had one IGS1 sequence and four strains had three different IGS1 sequences. In addition, L808 had two different IGS1 sequences. Thus, 92 IGS1 sequences (in total) were utilized in the next analysis(Appendix A).

3.2. Classification of the lGS1 polymorphisms

The 92 IGS1 sequences were divided into two distinct groups in the MP tree marked A and B, respectively(Fig. 2). This classification was related to sequence length of the 92 IGS1 sequences (Appendix A and Fig. 2). The IGS1 sequence lengths of Guangxiang 9-c1, Guangxiang 9-c2 and Cr01-c2 were larger than 1 100 nt. Their IGS1 sequences were distinct from the other 89 sequences,and they were incorporated into group B (bootstrap support=99%). The other 89 sequences were shorter that 1 100 nt and were grouped into group A, which was divided into six subgroups: A-1 (22 sequences), A-2 (19 sequences),A-3 (17 sequences), A-4 (12 sequences), A-5 (9 sequences),and A-6 (7 sequences). It should be noted that Guangxiang 51-c1, L121-c1 and L9319-c2 belonged to group A but did not fall under any particular subgroup.

Fig. 1 Intergenic spacer 1 (IGS1) agarose gels (1.2%) results for 48 Lentinula edodes cultivated strains in China. 1, Shenxiang 8;2, Shenxiang 10; 3, Shenxiang 12; 4, Cr02; 5, Minfeng 1; 6, Cr62; 7, Qingyuan 9015; 8, L241-4; 9, Ganxiang 1; 10, Jindixianggu;11, Senyuan 1; 12, Senyuan 10; 13, Senyuan 8404; 14, Guangxiang 9; 15, Guangxiang 51; 16, Huaxiang 8; 17, Huaxiang 5; 18,L952; 19, Junxing 8; 20, L9319; 21, Qingke 20; 22, L087; 23, L7401; 24, L8001; 25, Shenxiang 16; 26, L465; 27, L26; 28, L241;29, L04; 30, L1303; 31, Shenxiang 4; 32, L9015; 33, L9608; 34, Suxiang 1; 35, L937; 36, L939; 37, Xiangza 26; 38, Hunong 1;39, L7402; 40, Cr01; 41, L121; 42, L931; 43, L908; 44, Cr20; 45, Cr04; 46, L03; 47, L135; 48, L7405. M, D2000 DNA marker.

Fig. 2 The maximum parsimony (MP) tree and length of 92 intergenic spacer 1 (IGS1) sequences from 49 Leninula edodes cultivated strains in China. A-1, solid line in blue-green; A-2, green; A-3, orange; A-4, purple; A-5, dark green; A-6, dashed line in blue-green; B-1, blue.

The consensus sequence of A-1 was 988 nt in length,and its GC content was 36.13% (Fig. 3); 16 sequences were identical to the consensus sequence of A-1. The other six sequences had one or two mutated positions (mps) with the following consensus sequence: Junxing 8-c2 (GA),L087-c2 (AG, AG), L952-c1 (AT), Qingyuan 9015 (TC), Shenxiang 8-c2 (GA), and Suxiang 1-c2 (AG).Through TRF searching, four subrepeats were found in the consensus sequence of A-1 (Table 1).

The consensus sequence of A-2 was 1 040 nt in length,and its GC content was 36.06% (Fig. 3); 12 sequences were identical to the consensus sequence of A-2. The other seven sequences were different from the consensus sequences in some bases: L808-c2, L7402-c2 and Huaxiang 5-c2 all had one mp (AG) and had a base insertion (A); Cr62-c3 had one mp (TC); Shenxiang 16-c2 had one mp (TA);Qingyuan 9015-c1 had one mp (TA) and some base deletions (CC); and L7405-c2 had many base deletions(CC; AAG; T; AGTGTGT; TAAA). Through TRF searching,three subrepeats were found in the consensus sequence of A-2 (Table 1).

The consensus sequence of A-3 was 1 030 nt in length,and its GC content was 36.12% (Fig. 3); 14 sequences were identical to the consensus sequence of A-3. The other three sequences were different, with the following consensus sequences: L7401 (AG) and Shenxiang 10-c1(TA) both had one mp, and L7401-c3 had some base insertions (A; TAAA) and some base deletions (TTAATAA CAGTTCAGTCAGTAAGTGTGTT). Through TRF searching, three subrepeats were found in the consensus sequence of A-3 (Table 1).

The consensus sequence of A-4 was 933 nt in length,and its GC content was 36.66% (Fig. 3); 11 sequences were identical to the consensus sequence of A-4. Qingyuan 9015 had one mp (TC). Through TBF searching, three subrepeats were found in the consensus sequence of A-4(Table 1).

Fig. 3 Intergenic spacer 1 (IGS1) consensus sequence alignment for the seven Lentinula edodes subgroups. The identical bases are displayed in shadow. A and B are two distinct groups of 92 IGS1 sequences marked in the MP tree and 1-6 are subgroups.

The consensus sequence of A-5 was 1 003 nt in length and its GC content was 36.39% (Fig. 3); seven sequences were identical to the consensus sequence of A-5. L03-c2(TA) and L952-c2 (AG) had one mp, respectively.Through TBF searching, two subrepeats were found in the consensus sequence of A-5 (Table 1).

The consensus sequence of A-6 was 979 nt in length,and its GC content was 36.16% (Fig. 3); six sequences were identical to the consensus sequence of A-6. L7405-c1 had some base deletions (G; A) and some base insertions(CAGTTCAGTCAGTAAGTGTGTTAAGTTAATAA; A).Through TBF searching, five subrepeats were found in the consensus sequence of A-6 (Table 1).

Table 1 Subrepeat information for the seven Lentinula edodes subgroups

In group B, Guangxiang 9-c1, Guangxiang 9-c2 and Cr01-c2 all varied in terms of length and GC content.Compared with Guangxiang 9-c1 and Cr01-c2, Guangxiang 9-c2 was the longest sequence and had many base insertions. In this study, these three sequences fell under subgroup B-1 and had the same consensus sequence as Guangxiang 9-c2. Its length was 1 399 nt, and its GC content was 35.88%. Through TBF searching, six subrepeats were found in the consensus sequence of B-1 (Table 1).

3.3. lGS1 polymorphism map

A polymorphism map of 49 L. edodes cultivated strains was created according to their IGS1 classification (Fig. 4).Because Guangxiang 51-c1, L121-c1 and L9319-c2 did not fall under any subgroups in group A, they were marked as unknown.

Among the other 46 cultivated strains, 32 of them exhibited two polymorphism types: A-1/A-2 (Huaxiang 5,Huaxiang 8), A-1/A-3 (Cr04, Cr20, L26, L931, Junxing 8,Shenxiang 8, Shenxiang 10, Suxiang 1, Xiangza 26),A-1/A-5 (L03, L465, L952, L8001), A-1/A-6 (Cr02, L087),A-2/A-3 (Hunong 1, L7401, Senyuan 8404), A-2/A-4(Jindixianggu, L135, L937, L939 Qingke 20, Senyuan 10;Shenxiang 16), A-2/A-5 (L808), A-2/A-6 (L7402, L7405),A-3/A-6 (Senyuan 1), and B-1/A-6 (Cr01). Eleven cultivars exhibited a single polymorphism type: A-1 (Ganxiang 1,Shenxiang 4), A-2 (L241), A-3 (L04, Shenxiang 12), A-4(L908, L9015, L9608), A-5 (L1303), and B-1 (Guangxiang 9).Three cultivars exhibited three polymorphism types: A-1/A-2/A-4 (Qingyuan 9015), A-1/A-2/A-5 (Cr62), and A-2/A-3/A-4 (L241-4).

Fig. 4 Intergenic spacer 1 (IGS1) polymorphism map for 49 Lentinula edodes cultivated strains in China. A and B are two distinct groups of 92 IGS1 sequences marked in the MP tree and 1-6 are subgroups.

4. Discussion

Based on the results reported by Song et al. (2015),49 cultivars were considered to be widely utilized cultivated strains in China and were analyzed in this study. The traditional method for studying IGS1 polymorphisms is to measure how many electrophoretic bands are present.In this paper, 46 strains had only one electrophoretic band. However, through sequencing, most of strains with one electrophoretic band possessed two different IGS1 sequences. The same phenomenon was detected in a polymorphism of the ITS gene (Song et al. 2018b).Because the strains of L. edodes are heterokaryons, it is easy to deduce that having two nuclei with different IGS1 and ITS sequences may be the main reason for IGS1 and ITS polymorphisms in L. edodes. Prior to this study, ITS or IGS1 sequence differences among the dikaryotic mycelia of L808 and its two protoplast monokaryotic mycelia were determined. L808 have two different ITS (KY494478 and KY494479) and IGS1 sequences (MF177505 and MF177506). One of protoplast monokaryotic mycelia only had one of ITS sequence (KY494478) and IGS1 sequence(MF177505), respectively, and the other mycelia also only had one of ITS sequence (KY494479) and IGS1 sequence(MF177506), respectively (Song et al. 2018a, b). Thus, the heterokaryon of L. edodes may be the main reason for its higher number of ITS and IGS1 polymorphisms.

ITS and IGS1 are both located in rDNA repeats and their polymorphisms should be connected. Guangxiang 9 is developed by vegetative means from a wild strain in China;its ITS1/5.8S/ITS2 type was A/A/A2, and its IGS1 type was B.Cr01 is developed through cross breeding between L7402(introduced from Japan) and a wild strain in China. Its ITS1/5.8S/ITS2 type was mixed between A/A/A1 and A/A/A2, and its IGS1 type was mixed between groups A and B.It appears that the IGS1 type of each strain may be inherited from its parents, but actually, IGS1 is not able to inherit entirely homologous sequences and quickly shifts across the rDNA unit during mating events (Kwon et al. 2015, 2016).L241-4, L939 and Qingke 20 were systematically bred from L241, L9015 and Qingyuan 9015, respectively; Jindixianggu is the offspring of a cross between L135 and L939; Senyuan 10 is the offspring of a cross between L135 and Senyuan 8404; Shenxiang 10 is the offspring of a protoplast fusion between L26 and Suxiang 1; and Shenxiang 16 is the offspring of a protoplast fusion between L135 and L939(Song et al. 2015). Compared with their parents, L241-4 and L939 had a high number of IGS1 polymorphisms,respectively, but Qingke 20 had a low number of IGS1 polymorphisms. Jindixianggu, Shenxiang 16 and Shenxiang 10 had the same mumber of IGS1 polymorphisms as their parents. Senyuan 10 had a different number of IGS1 polymorphism than its parents.

There are two kinds of repetitive DNA in genome:interspersed repeats, which are distributed throughout the genome in an apparently random fashion, and tandem repeats, which are placed next to each other in an array(Jo et al. 2009). The IGS region (including IGS1 and IGS2)of each repeat unit contains an array of tandem repeated DNAs referred to as ‘subrepeats’ (Saghai-Maroof et al.1984). Saito et al. (2002) found that both IGS1 and IGS2 in L. edodes had subrepeats. By sequencing three cultivated strains, a subrepeat (which was close to the 5S rRNA and named SR1) was obtained. Heterogeneity in the lengths of IGS1 arises mainly from the number of different kinds of subrepeats within SR1. SR1 contains three types of subrepeats, and targeting their DNA fingerprints could be useful in investigating and discriminating among cultivated L. edodes strains. In this study, the subrepeat numbers and types were more varied because the investigation was based on a larger number of cultivated strains (49). The subrepeats were also close to that of 5S rRNA, but their sequences were all distinct for SR1. The main reason for this is that the method to determine subrepeat sequence was different. In this study, the professional software TRF was used to check subrepeat, but Saito et al. (2002) obtained the subrepeat by alignmenting sequences manually.

Though many studies have reported on the genetic diversity and classification of cultivated L. edodes strains in China (Fu et al. 2010; Liu et al. 2012, 2015), there has never been a valuable marker for classifying and managing cultivated L. edodes strains (only clustering results). In this study, an IGS1 polymorphism map for each cultivated L. edodes strain (based on clustering results) is reported for the first time. By using an IGS1 polymorphism map, the IGS1 polymorphisms and the classification of each cultivated strain can be easily checked and managed. Among these 49 cultivated strains, the major IGS1 polymorphisms were A1/A3 and A2/A4. There more IGS1 sequences will emerge in the future. To facilitate new IGS1 sequence classification,the consensus sequence of each subgroup in this study was provided for analysis (Fig. 3). Thus, an IGS1 polymorphism map can be used as a marker for initially classifying and managing cultivated L. edodes strains in China. IGS1 has proven to be useful in an assessment of heterogenicity for monokaryotic strains of Agaricus bisporus (Kwon et al.2015). Furthermore, an IGS1 polymorphism map could be applied to and complement polymorphism analysis of L. edodes in conjunction with breeding programs.

5. Conclusion

Intra-strain and intra-species polymorphisms of IGS1 are common in the 49 popular cultivated strains of L. edodes in China. The great majority of these cultivated strains possessed two different IGS1 sequences. By comparing the length and homozygy of IGS1 sequences, the 49 strains were classified into two groups: A and B. Forty-seven cultivars were homozygous or heterozygous among the six subgroups of group A, Cr01 was heterozygous between groups A and B, and Guangxiang 9 belonged to group B.The consensus sequence of each subgroup was provided for facilitating other new IGS1 sequence classifications. By using an IGS1 polymorphism map, the IGS1 polymorphisms and the classification of each cultivar can be easily checked and managed. The IGS1 polymorphism map can be used as a marker for the initial classification and management of cultivated L. edodes strains in China.

Acknowledgements

This work was supported by the earmarked fund for China Agriculture Research System (CARS-20), the Youth Talent Development Plan of Shanghai Municipal Agricultural System, China (20160113) and the Agriculture Research System of Shanghai, China (201809).

Appendixassociated with this paper can be available on http://www.ChinaAgriSci.com/V2/En/appendix.htm