Classical Ethylene Insensitive Mutants of the Arabidopsis EIN2 Orthologue Lack the Expected‘hypernodulation’Response in Lotus japonicus

Pick Kuen Chan,Bandana Biswas and Peter M.Gresshoff

1Australian Research Council(ARC)Centre of Excellence for Integrative Legume Research,The University of Queensland,St.Lucia,Brisbane QLD 4072,Australia(PKC,BB,PMG)

2ARC Centre of Excellence for Integrative Legume Research and School of Agriculture and Food Sciences,The University of Queensland,St Lucia,Brisbane QLD 4072,Australia

Introduction

Leguminous plants form nitrogen-fixing nodules on their roots,through an association with compatible soil bacteria commonly known as rhizobia.Nodules are unique root organs that provide a suitable environment for the nitrogenase enzyme complex of rhizobia to convert nitrogen gas from the atmosphere to ammonium,which can be assimilated by the plant for agronomic,environmental and economic gains.This symbiotic interaction is initiated by a complex exchange of signals between the two symbionts(Calvert et al.1984;Fischer and Long 1992;Geurts and Bisseling 2002;Ferguson and Mathesius 2003;Oldroyd and Downie 2004),with both formation and function of nodules regulated by endogenous plant signals(Caetano-Anollés and Gresshoff 1991;Oka-Kira and Kawaguchi 2006;Ferguson et al.2010)and environmental factors/stresses(Singleton and Bohlool 1984;Kirda et al.1989;Zhang et al.1996;Ligero et al.1999;Marino et al.2006).

The gaseous plant hormone ethylene serves as an important regulator of various developmental processes and ‘fitness’including germination,fruit ripening,root nodulation,and responses to stress and pathogen attack(Kieber 1997;Clark et al.1999;Alonso and Stepanova 2004;Yoo et al.2009).Early reports already suggested that exogenous ethylene reduced nodule numbers of pea(Pisum sativum)and white clover(Trifolium repens)when grown in soil ventilated with air containing ethylene(Grobbelaar et al.1971;Goodlass and Smith 1979).The treatment of legume roots by ethylene or ethylene precursors(such as ACC,1-aminocyclopropane 1-carboxylic acid)also inhibited nodulation in soybean(Glycine max;Caba et al.1999),L.japonicus(Lohar et al.2009;Gresshoff et al.2009)Phaseolus vulgaris(Grobbelaar et al.1971),P.sativum(Lee and La Rue 1992)and M.truncatula(Penmetsa and Cook 1997).

In contrast,several reports showed that exogenous treatments of soybean with ethylene or ethylene inhibitors did not affect nodule number(Hunter 1993;Suganuma et al.1995;Schmidt et al.1999).These findings could be explained by experimental differences(culture systems,level of treatment strength)or plant genetic variation.For example,Xie et al.(1996)demonstrated that soybean cultivars differed in their natural ethylene responsiveness.Also,Lee and La Rue(1992)indicated that the formation of nodules on soybean roots was less sensitive to exogenous ethylene than they were on other leguminous plants,perhaps a reflection of the determinate vs.indeterminate nodule ontogeny(c.f.,Ferguson et al.2010 for a depiction of the nodule ontogeny reflecting the differential maintenance of the induced nodule meristem).Effects of ethylene on nodulation were also demonstrated through the application of inhibitors of ethylene synthesis(e.g.,AVG,L-α-(2-aminoethoxyvinyl))and perception(e.g.,silver ions),by an increased nodule number on M.sativa(Peters and Crist-Estes 1989;Caba et al.1998),P.sativum(Fearn and LaRue 1991;Guinel and LaRue 1992)and L.japonicus(Nukui et al.2000).

The mechanism of selective ethylene inhibition on nodulation,as compared to root growth,is still unknown,and ethylene may be involved at various stages of nodule development.In P.sativum,exogenous ethylene application did not decrease the number of infection threads but blocked the infection thread(IT)entering the inner cortex(Lee and La Rue 1992).The degree of IT abortion in sickle,an ethylene insensitive mutant in M.truncatula,was very low,further supporting the idea that ethylene has a role in infection thread progression(Penmetsa and Cook 1997).Later,Oldroyd et al.(2001)showed that ethylene regulated the success of infection thread growth by acting upstream or at the point of calcium spiking,therefore at the early stage of the Nod factor signal transduction pathway.

Ethylene not only controls infection but also the radial positioning of nodule initiation.Normally,legume nodules arise from cell division in both cortical and pericycle cells in a radial sector opposite xylem poles(c.f.,Libbenga et al.1973;Lohar et al.2009).Heidstra et al.(1997)detected in situ accumulation of ACC oxidase mRNA in cells opposite phloem poles of Vicia sativa sp.nigra,a location where nodule primordia are normally not seen after inoculation with rhizobia,as most(90%)develop off pericycle cells adjacent to xylem poles,the same position of lateral roots induction.They suggested that localised localized ethylene release inhibited nodule induction at an early stage,consistent with Oldroyd’s later results,and thus provided positional information for nodule initiation.The ethylene insensitive mutant of M.truncatula,sickle(Penmetsa and Cook 1997)and ethylene insensitive transgenic L.japonicus expressing ethylene receptor ETR1-1(Gresshoff et al.2009;Lohar et al.2009)have such altered nodule positioning,along with the classical‘Triple Response’phenotype seen in most vascular plants(Guzman and Ecker 1990).Together,these data support the strong inhibitory role of ethylene in nodule positioning.

Ethylene also affects nodule morphology;for example,the number of bacteroids per symbiosome in the ethylene insensitive transgenic Lotus ETR1-1 was twice as large as in the wild type,indicating that ethylene may regulate rhizobial cell division directly or indirectly by altering the internal nodule environment(Lohar et al.2009).Likewise,in Sesbania rostrata roots,differential ethylene treatment determined the phenotypic plasticity in root nodule development(Fernández-López et al.1998).

Pioneering work was carried out with the M.truncatula ethylene insensitive mutant,sickle(Penmetsa and Cook 1997;Prayitno et al.2006;Penmetsa et al.2008).sickle,selected from EMS-mutagenized M.truncatula for defects in symbiotic interactions,was defective in ethylene perception.Later,other alleles of sickle(which is an orthologue of the Arabidopsis EIN2 gene)were isolated,and all showed increased nodule number per root,accompanied by increased IT persistence(Penmetsa et al.2008).sickle retained the endogenous autoregulation of nodulation(AON;Delves et al.1986),and all hypernodulating/supernodulation mutants of L.japonicus(har1–1),soybean(nts382/nts1007)and M.truncatula(sunn)are ethylene sensitive(Wopereis et al.2000),though Ligero et al.(1999)found some differential ACC response in supernodulating(GmNARK-deficient;Searle et al.2003)nts382 soybean.This suggested that ethylene was not involved in the control of nodulation through autoregulation per se.Ethylene insensitive transgenic of L.japonicus expressing ethylene receptor Cm-ERS1/H70A(Nukui et al.2004)and AtETR1-1(Gresshoff et al.2009;Lohar et al.2009)further confirmed that ethylene perception is independent of autoregulation.

With the aim to further dissect the involvement of ethylene in nodulation,we screened EMS-mutated L.japonicus MG-20 M2 lines for defective ethylene perception.Here,we report the characterisation of three independent L.japonicus ethylene insensitive mutants,altered in the Lotus gene(LjEIN2a)orthologous to Arabidopsis EIN2 that display reduced nodule number,enigmatic to the expected increased nodulation phenotype seen in other L.japonicus ethylene transgenics and the M.truncatula mutant sickle.

Results

Ethylene sensitivity of enigma mutants

We screened seedling germination and growth of three thousand EMS-mutagenized families of L.japonicus MG-20(60,000–70,000 seeds in total)for the lack of the ‘Triple Response’,i.e.,inhibition of root and hypocotyl elongation,radial swelling of hypocotyl and exaggerated apical hook in the dark with ethylene treatment(Guzman and Ecker 1990,Lanahan et al.1994;Ecker 1995)on medium with 100μM ethephon,a commercially used ethylene precursor(and a less costly option than ACC).Several ethylene insensitive lines were isolated from this primary selection,and subsequent retesting of sibling seeds after application of ethylene gas and germination on medium containing ACC,an ethylene precursor(Adam and Yang 1979;Yu et al.1979).Several lines were insensitive to both inhibitors;three(enigma-1,-2 and-3)were picked for further characterisation,though most results were derived from enigma-1.

Plant growth and physiology

The hypocotyl growth responses of MG-20 and enigma-1 seedlings to exogenous ACC and/or ethylene gas are shown(Figure 1A,B).These were similar to mutants defective in ethylene perception in Arabidopsis,tomato and M.truncatula(Bleecker et al.1988;Chang et al.1993;Lanahan et al.1994;Penmetsa and Cook 1997),supporting the conclusion that the enigma mutants possess ‘classical’ethylene insensitivity.

enigma-1 grew to maturity without displaying major morphological changes.The plants were fertile and developed seeds normally.However,enigma-1 plants grew slower,had delayed flowering time,and showed reduction in the size of seed pods and leaves compared to wild type plants(Figure 1C).These phenotypes may be caused by collateral mutational damage,though they are common to all three independent allelic mutants.Thus,the ethylene insensitivity phenotype identified at the seedling stage exerted effects during the adult stage of growth.Measured at 4 w after germination,the enigma-1 mutant had a slightly increased number of lateral roots(45±12)compared to the wild type(32±9),with 41%greater dry weight of roots(Figure 1D,E).The increased dry weight of the enigma-1 root resulted in a shift of shoot-to-root ratio(3.7 vs.2.4,MG-20 vs.enigma-1(Figure 1E).

Genetic analysis

The enigma-1 mutant was crossed with the non-parental wild type L.japonicus Gifu B-129 for the purpose of genetic mapping and segregation analysis.From a total of 599 F2 progenies,141 were ethylene insensitive and 458 were ethylene sensitive and thus segregated at a ratio of 1:3(χ2=0.345;p ＞0.2).Genetic analysis indicated that the ethylene insensitive phenotype of enigma-1 is recessive.Mapping using simple sequence repeat(SSR)markers placed the Enigma locus onto L.japonicus Chromosome 1 close to marker TM0033 at position 69.8 cM(position 58,963,229–58,687,139;c.f.,Hirokawa et al.1998;Hayashi et al.2001;www.kazusa.org.jp).Using a candidate gene approach,we propose that the LjEIN2a gene,known to encode an integral ER membrane protein acting downstream from ETR1 and CTR1 in the ethylene perception pathway of Arabidopsis,is located at this region(Bisson et al.2009).A duplicate copy(LjEIN2b)was found on L.japonicus Chromosome 5(position 10,193,466–10,186,945;Desbrosses and Stougaard 2011).Sequencing analysis of the Lotus candidate LjEIN2a gene in mutant enigma-1 revealed three point mutations at nucleotide positions 3,958(A to G),4,022(G to A)and 5,989(G to A),which conferred the amino acid changes at protein positions 660(Ser to Gly)and 681(Arg to His)(Figure 2A).The point mutation at position 5,989 was equal-sense,and thus presumed to be silent.Two additional alleles(enigma-2;enigma-3)were further characterised after the initial‘Triple Response’assay to confirm critical phenotypes in independent isolates,eliminating the chance of background mutations(so-called ‘collateral damage’).enigma-2 has a point mutation at nucleotide position 5,466(G to A)that,if translated,would result in a truncated(presumed non-functional)protein,while enigma-3 has a point mutation at 1,441(G to A)within an intron(possibly creating a site for alternative splicing).All three mutants,despite diverse nucleotide changes,resulted in increased root elongation in the presence of ethylene and reduced nodulation.

The expected increased nodulation phenotype(by analogy to M.truncatula sickle,and Lotus transgenics for dominant insensitivity ETR1 receptors)was not detected.Multiple sequence alignments of the newly discovered LjEIN2a and b genes with EIN2 sequences of M.truncatula,soybean,tomato and Arabidopsis thaliana,revealed a high degree of similarity(Figure S1).One notes that LjEIN2a is predicted to lack 38 amino acids in the N-terminal region(residues 155–193),possibly related to a receptor or protein interaction domain,compared to MtEIN2 and LjEIN2b.Furthermore,both LjEIN2a and LjEIN2b lack 50–56 amino acid residues relative to MtEIN2 and AtEIN2,explaining possible differences in the adult stage fruit phenotype,where Arabidopsis ein2 mutants have longer siliques and dry weight.Bioinformatics search defined a GmEIN2-like protein from soybean(Glycine max)highly similar to that from M.truncatula and Arabidopsis.

Figure 1.Growth phenotypes of enigma-1 mutant.(A)Sensitivity of 7–d-old MG-20 and enigma-1 seedlings,germinated in the dark,to ethylene gas(0 to 100 ppm).The triple responses phenotype of the wild type is shown by the shortening of hypocotyls and roots,radical swelling of stems and apical hook formation.Bar,1 cm.(B)Hypocotyl growth response to different concentrations of ethylene in MG-20(purple)and enigma-1(magenta)(n=14 to 34).Bars indicate SD.(C)Mature seed pods of enigma-1 and MG-20.Bar,1 cm.(D)Plants grown in plastic growth pouches for 4 w,showing difference in number of lateral roots in MG-20 and enigma-1.(E)Dry weight of 4-w-old seedlings of MG-20 and enigma-1,grown in plastic growth pouches.

Figure 2.Genetic position and nodulation response of three independent enigma alleles.(A)The predicted positions of 12 transmembrane helices of LjEIN2 are shown as cylinders through plasma membrane.Note:enigma-1 has three point mutations indicated as enigma-1a,-1b and-1c.enigma-3 is not shown as it is mutated in an intron.The structure was predicted using SOSUI prediction software at http//bp.nuap.nagoya-u.ac.jp/sosui/.(B)Nodule numbers in MG-20,enigma-1,enigma-2 and enigma-3,grown in pots with vermiculite.Nodules were scored 4 w after inoculation(n=30).Bars show SD.

Nodulation phenotype of enigma mutants

Nodule numbers per plant are reduced by EIN2 mutations in enigma lines

Inoculation of enigma-1,-2 and-3 seedlings(grown in potting soil)with Mesorhizobium loti strain BNO2produced healthy red nodules,but at a reduced nodule number compared to MG-20(Figure 2B).When inoculated with M.loti strain NZP2235,similar differences in nodule number per plant were determined,illustrating that the phenotype was not microsymbiontdependent(data not shown).

Table 1.Nodule numbers and root growth of hypocotyl-grafted plants involving enigma-1 and MG-20

Nodulation phenotype in enigma-1 is both root and shoot controlled

To determine whether the decreased nodulation phenotype of enigma-1 was controlled by the shoot or the root,reciprocal hypocotyl grafts were made between the MG-20 and enigma-1(c.f.,Buzas and Gresshoff 2007 for micro-grafting technique).As shown in Table 1,grafting of MG-20 shoots onto enigma-1 roots resulted in reduced nodule number/plant.Likewise,when enigma-1 shoots were grafted onto MG-20 roots,an enigma nodulation phenotype(number and pattern)was observed.MG-20 to MG-20 and enigma-1 to enigma-1 control grafts(16.9 and 5.2 nodules per plant)showed similar results to non-grafted plants.These results indicated that the decreased nodulation phenotype of enigma-1 is controlled by both shoot and root tissues.This finding is in contrast to sickle as its nodulation phenotype is entirely root-controlled(Prayitno et al.2006).

Fewer infection threads are formed in enigma-1 root

To investigate the stage at which the reduction of nodules occurred in the enigma-1 root,we infected enigma-1 and MG-20 with M.loti strain BNO2,which constitutively expresses green fluorescent protein(GFP).Root hairs of both enigma-1 and MG-20 showed similar types and degree of deformation.The number of infection threads per root was scored on day 8 post-infection.There were 10.6±1.0 infection threads/root formed in enigma-1 roots compared to 18.4±2.3 on wild type roots.This represents a reduction of 42%of detectable infection threads/root in enigma-1 relative to MG-20,even though there was no significant difference in their root lengths.The morphology of infection threads(at the light microscopy level)formed in enigma-1 roots appeared to be similar to the wild type,as was the structure of the nodule primordia formed in enigma-1 and MG-20 roots.

Nodule position is different in enigma-1

Thick sections of nodulating roots of enigma-1 and wild type were scored to determine the frequency of nodules originating from the commonly accepted source tissue opposite protoxylem poles.About 32%of nodules formed within a 20 degree sector opposite the protoxylem pole in enigma-1(meaning that 68%formed between xylem pole radial sectors)compared to 69%in MG-20(Table 2).Thus,the enigma-1 mutant is impaired in its control of nodule radial positioning,in agreement with the role ethylene plays in controlling the position of nodule in other legumes.

Mycorrhizal colonisation

L.japonicus can form root symbiosis with arbuscular mycorrhizal(AM)fungi belonging to the division Glomeromycota(Kistner et al.2005).We investigated the possibility of effects in mycorrhizal colonisation and penetration in enigma-1,and showed it to have a mycorrhization phenotype similar to MG-20 when colonized by Glomus intraradices(Figure S2).

Ethylene production by enigma-1

Some plant mutants possess altered ethylene synthesis and release and show the classic ‘Triple Response’(Bleecker et al.1988),whereas other mutants appear insensitive to exogenous ethylene(Guzman and Ecker 1990).Ethylene produced by intact enigma-1 seedlings showed a doubled level compared to wild type during a 24-h assay(Table 3).This difference was noticed in whole plants as well as separated shoots and roots(wounded for separation).Thus,increased ethylene production in both roots and the shoot explained the grafting phenotype of enigma-1,as either gaseous ethylene or its precursor ACC would move systemically.

Table 2.Radial origin of nodules in relation to the protoxylem pole in enigma-1 and MG-20

Sensitivity of enigma-1 to exogenous nitrate and abscisic acid(ABA)

Nodule formation in L.japonicus was moderately sensitive to exogenous nitrate(Hussain et al.1999;Nishimura et al.2002).We examined the effect of exogenous nitrate on nodule formation by enigma-1 and MG-20 plants.Varying concentrations of potassium nitrate were applied to plants in plastic growth pouches.Nodule number/plant of both enigma-1 and MG-20 was inhibited by concentrations up to 15 mM nitrate(Figure 3).enigma-1 appeared to have increased sensitivity to high nitrate levels compared to MG-20,if expressed on a percentage of control.Nodule size was also reduced in these high nitrate treated plants.

Table 3.Ethylene production?of wild type and enigma-1 mutant

Arabidopsis EIN2 mutants have altered sensitivity to abscisic acid(ABA;Alonso et al.1999;Beaudoin et al.2000;Ghassemian et al.2000),and connecting response mechanisms of ethylene and ABA.Low(0.1μM)ABA promoted nodulation in enigma-1 only(Chen PK,unpublished data).However,at a higher concentration,ABA had an inhibitory effect on nodule numbers in both enigma-1 and MG-20.This result was consistent with the findings of Biswas et al.(2009)that ABA at a low concentration was required for nodule growth in L.japonicus.Germination assays revealed increased sensitivity to ABA in enigma-1 compared to MG-20(Figure 4)as reported in Arabidopsis EIN2 mutants(Beaudoin et al.2000).The ABA level in enigma-1 was measured and displayed an increase of about 55%compared to MG-20,indicating that ethylene sensitivity and ABA synthesis were co-regulated(c.f.,Wang et al.(2007)for Arabidopsis).

Figure 3.Regulation of nodule number of enigma-1 and MG-20.(A)Nitrate inhibition:Plants were grown on plastic growth pouches and irrigated with Broughton and Dilworth(B&D)medium(n=11–to 20).Nitrate was supplied as KNO3.KCl controls at 25 mM had no nodulation effect.Bars indicate SD.(B)1-aminocyclopropane 1-carboxylic acid(ACC),as ethylene precursor,inhibition:Plants were tested on agar-plates with lightshielded roots.Note:nodulation under these conditions is not optimal,and does not reflect pouch or soil-grown plantlets.enigma-1 is not inhibited by ACC under the tested conditions,while MG-20 nodulation is.

Gene expression(qRT-PCR)in response to ACC treatment

Mature plantlets(4-w-old),grown asymbiotically on nitrate medium(1/2 B5 mineral salts,no sucrose)were analyzed for gene expression of a small group of genes,commonly associated with ethylene response.ACC,as a precursor of ethylene gas,was provided to the plantlets for 0,2 and 18 h,and relevant transcript amounts were deduced from total shoot and total root cDNA.This approach gave a global tissue response,but hides localized effects in different root or shoot parts.(c.f.,Hayashi et al.(2012),who analysed gene expression in the nodulation-responsive area of soybean roots to discover gene responses previously hidden in whole root transcript profiling).

The gene encoding a major ethylene receptor gene LjETR1(c.f.,Lohar et al.2009;Gresshoff et al.2009)was expressed equally in shoots of both MG-20 and enigma-1 with no change over the 18-h assay period(Figure 5A),while expression in the root increased two-fold for MG-20 and more than 100-fold for enigma(starting for at an extremely low expression level).A similar response was observed for LjEIL3(Figure 5B).Both genes were expressed at a level significantly below that of the wild type at the time of transfer but then responded strongly,in contrast to expression in the wild type.We also analyzed the pathogenicity-related gene(LjPR1)and found that its expression response,though low,was similar in wild type and mutant shoot tissue,but differed significantly,with MG20 roots showing a large increase over 18 hours,while enigma roots retained a low value(data not shown).

Figure 4.Abscisic acid(ABA)inhibits seed germination of MG-20 and enigma-1.Seeds were germinated in the dark on filter paper soaked with different concentrations of ABA(n=30).Bars indicate SD.

Discussion

Here,we describe the isolation and characteristics of EIN2(ethylene insensitivity 2)mutants of the legume L.japonicus that showed classical ethylene insensitivity as determined by the ‘Triple Response’assay on germinating seeds.Surprisingly,and in contrast to the well-characterised M.truncatula sickle mutants (Penmetsa and Cook 1997;Prayitno et al.2006;Penmetsa et al.2008;Prayitno 2010),three independent mutants,namely enigma-1,-2 and-3,lacked the expected so-called‘hypernodulation’response.Indeed,nodule numbers/plant were marginally reduced whether grown in plastic growth pouches(assumed to be intermittently stressed)or soil(presumed unstressed).The phenomenon was independent of the type of bacterial inoculant.

Figure 5.Transcript analysis in enigma-1 mutant of Lotus japonicus.Seedlings were exposed to 1-aminocyclopropane 1-carboxylic acid(ACC)ACC for 0,2(short term)and 18 h(long term).Assayed genes were LjETR1(A),LjCTR1(never-ripe like;B),and LjEIL3(C).Red,LjEIN2a shoot;White,MG-20 shoot;Purple,LjEIN2a root;Orange,MG-20 root(for all A,B,and C).

The defect in ethylene perception did not interfere with the ability of the three enigma mutants to grow to maturity with a normal,though delayed,capability to form seeds.However,alterations in the ‘Triple Response’during the seedling stage were observed during adult growth,with slower growth and reduced size of pods and seeds.At present,we cannot exclude the influence of mutational collateral damage(background mutations)affecting the fitness of the mutants,though the common occurrence in three independent lines suggests a shared pleiotropic effect of the gene alteration.Reduced growth is a consistent phenotype with ethylene insensitive mutants in Arabidopsis(Guzman and Ecker 1990),tomato(Lanahan et al.1994)and in transgenics of L.japonicus expressing ethylene receptor Cm-ERS1 or AtETR1-1(Nukui et al.2004;Lohar et al.2009,respectively).

All three enigma alleles segregated in a Mendelian recessive manner,predicting a loss-of-function nature.The mutants’phenotypes reflected expected changes associated commonly seen with ethylene insensitivity,namely ethylene insensitivity during dark germination,delayed flowering,decreased plant and seed size,increased lateral root number,as well as increased endogenous production of ethylene and ABA.

We determined that all three enigma mutants were mutated in the LjEIN2a gene(chromosome 1).Nucleotide alterations leading to amino acid changes or termination of peptide synthesis were detected.enigma-1 is characterized by three mutational changes.Such clustering may reflect an originally high mutagenesis efficiency,co-incidence or the position of a replication fork during mutagen treatment.

The new EIN2a Lotus ethylene insensitive mutants present an enigma,as other Lotus transgenics(albeit caused by insensitive ETR1 overexpression)showing ethylene insensitivity showed increased nodulation(Nukui et al.2004;Lohar et al.2009).In contrast to the M.truncatula ‘sickle’mutant(also altered in EIN2),enigma mutants showed a reduction of IT formation/progression and decreased nodule formation.The lack of increased nodulation caused by ethylene insensitivity in enigma mutants was verified through segregation analysis(linking the enigma-1 phenotype to its mutant allele),and by the characterisation of three independent lines,thereby reducing the risk of collateral mutagenesis damage suppressing or altering the expected phenotype.

To understand the nature of the enigma mutants,we analysed analyzed further physiological responses.Roots of enigma-1 overproduced ethylene as well as ABA.This response was similar to the ethylene insensitive mutants Atetr1 and Atein2 as they block the negative feedback regulation of ethylene biosynthesis,leading to an increase in ethylene production(Woeste et al.1999).However,the amount of ethylene produced by enigma-1 seedlings may only have been sufficient to result in a moderate morphological response(i.e.,40%lateral root increase)as seen in Arabidopsis mutant eto1(ethylene overproducer;Guzman and Ecker 1990),though local expression maxima may exist in legumes distinct from those in Arabidopsis.However,the Ateto1 mutant overproduced substantially more ethylene,possibly reflecting a concentration effect in the morphological response.

enigma-1,described here in the most detail,developed normal,nitrogen fixing nodules after inoculation with M.loti.Like its parent MG-20,nodulation of enigma-1 was inhibited by 15 mM nitrate,suggesting that the nitrogen control of nodulation may not be mediated through ethylene.enigma-1 also exhibited normal mycorrhizal colonization.

Plants expressing mutant alleles of the LjEIN2a gene displayed an enhanced response to ABA in seeds,leading to decreased seed germination.However,enigma-1 mutants displayed a lack of ABA inhibition of root growth,suggesting that,are distinct in roots,the ABA and ethylene pathways.Arabidopsis EIN2 modulates stress response through an ABA response pathway as disruption of EIN2 caused a substantial increase in ABA production(Wang et al.2007).Similar links of ethylene,ABA,nodulation and lateral root formation were observed in the LATD mutant of M.truncatula(Harris and Dickstein 2010).

RNA expression analysis was used to compare root and shoot tissue transcript amounts at 4 w,and then responses to overnight exposure to ACC(an ethylene precursor).It is noted that ACC is converted to ethylene by ACC oxidase,whose responsible gene is strongly ethylene regulated.Significantly,for LjETR1,LjEIN3 and LjNRL1(never-ripe like 1 being similar to AtCTR1,the first step after ethylene perception and acting prior to EIN2),expression levels in 4-w-old shoot tissue were equivalent,and response to ACC treatment was minimal.In contrast,transcript levels for the same three genes in 4-w-old whole roots differed significantly with enigma-1 roots,showing extremely low values compared to wild-type MG-20.However,in response to a high ACC concentration for 18 h,the enigma-1 roots for all three genes responded stronger than MG-20 roots.Only expression levels of the pathogenicity related gene(LjPR1)demonstrated a lack of response to ACC in enigma-1 roots over the 18-h period,while those of MG-20 increased dramatically,even as early as after 2 hours.

The discovery of three allelic ein2 mutants in L.japonicus lacking the anticipated ‘hypernodulation’response was surprising.Previous studies with the temperate legume M.truncatula(Penmetsa and Cook 1997)showed that the sickle mutant(altered in MtEIN2;Penmetsa et al.2008)developed an increased number of infection threads and nodule primordia.EIN2 in Arabidopsis was previously shown to be part of the ethylene response pathway,initiated by ethylene receptors such as ETR1 and then CTR1.The EIN2 protein in Arabidopsis localized in the endoplasmic reticulum where it interacted with ETR1(Bisson et al.2009).Mutation and dominant transgenic studies in L.japonicus,a determinate type nodulator(Jiang and Gresshoff 1997),likewise demonstrated that alterations in ethylene sensing resulted in increased nodule number/plant,altered positional radial nodulation pattern,and delayed floral/seed maturation along with the classical‘Triple Response’of seedling germination(Lohar et al.2009;Gresshoff et al.2009;Nukui et al.2000).This generated a paradox:how can enigma mutants,showing classical ethylene insensitivity phenotypes,lack the anticipated increased nodulation phenotype,while the ethylene insensitivity transgenics do have the increased nodulation phenotype?

The recent discovery of a second EIN2 gene(LjEIN2b;Desbrosses and Stougaard 2011)in L.japonicus(chromosome 5 as compared to chromosome 1 for the enigma locus)may provide a reasonable hypothesis for these divergent and unexpected results.LjETR1,functioning prior to LjEIN2a and LjEIN2b,will commonly activate the two downstream steps.It is likely that LjEIN2a functions in classical Triple Response steps in all tissues,and most likely also the nodulation regulation cascade,but this function is duplicated for nodulation only and not the other ethylene control targets.Thus,the enigma mutants are altered in the classical Triple Response but not the negative ethylene response on nodulation,as LjEIN2b complements the mutated LjEIN2a locus.

Materials and Methods

Plant materials and growth condition

Lotus japonicus Miyakojima MG-20 was used as the wild-type control in all experiments and was the parent to the mutants.Seeds were scarified by gentle treatment with sand paper,were surface-sterilized using 70%ethanol for 10 min followed by 5 rinses with sterile dH2O,and were germinated on wet filter paper under sterile conditions.The seeds were germinated in the dark at 25°C for 2 d.Seedlings were transferred to vermiculite supplied with Broughton and Dilworth(B&D)medium plus 2 mM KNO3(Broughton and Dilworth 1971)or plastic growth pouches(Mega International,Minneapolis,MN,USA)and grown in a controlled environment with 18/6 h day/night cycle at 24°C/18°C temperature regimen.

Isolation of ethylene insensitivity mutants

Seeds(20–25)from three thousand M2families(total about 70,000 seeds were screened)of an ethyl methyl sulfonate(EMS)mutagenized population of MG-20(Biswas et al.2009)were sterilized,germinated and transferred to 1/2 strength Gamborg’s B5 medium(Sigma,St Louis)(Gamborg 1970)containing 100μM ethephon.The seedlings were incubated the dark for 5–7 days d at 24°C.After selection,putative mutants were transferred to vermiculite and allowed to self-pollinate,and the M3seeds were retested for the mutant phenotype with ethephon,1-aminocyclopropane-1-carboxylic acid(ACC;Sigma,St Louis)and ethylene gas.

Microbial strains

Mesorhizobium loti BNO2,which constitutively expressed GFP,was used for all nodulation experiments.The M.loti strains were grown at 28°C for 2 d in YMB medium(Handberg et al.1994)supplemented with gentamicin at 5μg/ml.

Nodulation assay

Germinated seedlings were transferred to plastic growth pouches(Mega International,Minneapolis,MN,USA)and irrigated with B&D medium plus 2 mM KNO3(grown under 16 h/8 h photoperiod with at 24°C.).This level of nitrate did not affect nodulation but helped plant vigour.Two d later,the seedlings were inoculated with about 5×108cell/mL of M.loti BNO2per pouch.Pouches were shielded from light by cardboard sleeves;nodules were scored four w after inoculation.Potassium nitrate(Sigma,St Louis)of different concentrations was added to B&D.Pouches were kept moist(but not flooded)by the addition of sterile distilled water;over-watering was avoided.Nodulation assays were also carried out in pots with vermiculite grade 3 supplied with Broughton and Dilworth(B&D)medium plus 2 mM KNO3.

Seed germination assay

A seed germination assay was done by imbibing scarified seed of mutants and MG-20 in a solution containing ABA for 30 min.The seeds were then transferred to Petri dishes containing filter paper soaked with appropriate ABA solutions and incubated in the dark at 25°C.Germination was scored 5 d after transfer.

Measurements of endogenous ABA

Leaves(1 g fresh weight)were harvested from two-m-old enigma-1 and MG-20 plants grown under normal conditions.ABA was extracted as described by Biswas et al.(2009).The total ABA contents were determined by an enzyme-linked immunosorbent assay(ELISA)as previously described by Biswas et al.(2009).

Quantification of infection thread formation

Three-d-old seedlings were inoculated with about 5×108cell/mL of M.loti BNO2in pots containing vermiculite grade 3.The number of infection threads was visualized over the entire root length under using a Nikon E600 microscope(Nikon,Tokyo).

Mycorrhizal colonization

For mycorrhizal infection assays,plants were grown in a soil/sand mix(1:9)and inoculated with Glomus mossae propagated in a similar growth medium beforehand.Plants were harvested 6 w after inoculation and stained according to Vierheilig et al.(1998).

Dry weight determination

For growth measurement,four-w-old seedlings grown in-pot were uprooted,dissected and dried in the oven at 65°C for 2 d.The dried plant materials were weighed.

Ethylene measurement

Ethylene production was measured on three-w-old seedlings grown in plastic growth pouches with cardboard shielding to grow roots in the dark.Pouches were irrigated with B&D nutrient solution.The seedlings were transferred to 4 mL tubes sealed with PTFE/silicone liner cap.Seedlings were also separated into root and shoot portions for the evaluation of ethylene production from different tissues.The seedlings or plant portions were held at 23°C for 18 hr or 24 hr in the light to induce partial stress conditions.One mL samples were taken from the headspace and injected into a gas chromatograph(GC-10,Shimadzu,Kyoto,Japan).

Grafting

Germinated seeds were transferred to 1%agar slope with 1/2 × Gamborg’s B5 salts.After 2 d,micro-grafting was performed on the seedlings as described by Buzas and Gresshoff(2007).

Genetic analysis and mapping of enigma-1

L.japonicus Gifu B-129 was used as a crossing partner with enigma-1.The resulting F1 plants were self-fertilized,and 49 F2 plants with the ethylene insensitive phenotype were selected by root growth assay and used for further mapping analysis.DNA was prepared using with plant leaf material using the CTAB method.The samples were ground under liquid nitrogen and placed in a tube.CTAB buffer(1,000μL;2%CTAB;100 mM Tris pH 8;20 mM EDTA pH 8;1.4 M NaCl and 0.5%β-mercaptoethanol)was added to the sample and incubated at 65 ?C for 30 min to 1 hr.Chloroform(650 μL)was added to the sample.The mixture was mixed and incubated at room temperature for 15 min.Samples were centrifuged at 12,000 rpm for 10 min(in an Eppendorf microfuge).The supernatant was transferred to a tube containing 600μL cold isopropanol and mixed by turning.DNA was pelleted by centrifuging at 12,000 rpm for 10 min.DNA was washed in 70%ethanol before air drying and resuspending in 50 to 100μL of dH2O for further work.For mapping,28 simple sequence repeat(SSR)markers in the genetic linkage map of L.japonicus(Hayashi et al.2001)were selected.Fragments were separated in 8%polyacrylamide gels and stained with ethidium bromide.

Cloning of the LjENIGMA mutations

The LjEIN2a genomic sequences were cloned from enigma-1 and MG-20 with primer sequences L.japonicus EIN2aF,5′-ATGGAAGCAGAGACATTGAG-3′and L.japonicus EIN2aR,5′-CTAGCTGTATGATGATGCTG-3′.An Expand Long Template PCR System(Roche,Germany)was used for amplification;cloning was carried out with a TOPO XL PCR Cloning kit(Invitrogen,Carlsbad,USA).DNA sequencing was done by AGRF(Brisbane,Australia).

The structure was predicted using the SOSUI prediction software at http//bp.nuap.nagoya-u.ac.jp/sosui/(Hirokawa et al.1998).

Gene expression analysis

RNA expression of selected genes associated with ethylene(or ACC)responses was assayed by qRT-PCR.Seedlings of enigma-1 and MG-20 were grown on 1/2 B5 agar-solidified medium(+0.06%MES,pH 5.7)in a growth chamber at 24°C/22°C(18 h per day)for 4 w,then carefully harvested and exposed to ACC for 0,2 and 18 hr(on agar plates containing ACC(10μM)).

DNase treatment was performed on approximately 1μg of total RNA using DNaseI containing MgCl2(Fermentas,Burlington,Canada)at 37°C for 40 min.The treatment was terminated with the addition of 1μL of 25 mM EDTA,incubated at 65°C for 10 min.The cDNA synthesis was carried out by adding 0.5μg of DNase-treated RNA,1μL of 50μM oligo dT primers and 1μL of 10 mM deoxynucleoside triphosphates(dNTPs)followed by 5 min incubation in at 65°C.A master mix containing 4μL of 5X first strand buffer,1μL of 0.1 M dithiothreitol(DTT),1μL of 40 U of RNaseOUTTM(Invitrogen)and 0.5μL of 200 U of SuperScript IIIR○reverse transcriptase(Invitrogen)was prepared and added into the reaction.The reaction was incubated at 50°C for 1 h.The complete cDNA synthesis was verified by PCR using LjUbiquitin gene targeted primers.Primers were designed by Primer Express software.L.japonicus ubiquitin was used a housekeeping reference gene.The optimization of primer concentration was carried out in 5-fold serial dilution at 0.5μM,1μM and 1.5μM of the respective primers using an ABI 7900HT cycler in a 384-well plate with 2X SYBR green fluorescence detection.

Primer sequences are as follows(forward;reverse(all 5′to 3′)):LjUbiquitin:TTCACCTTGTCTCCGTCTTC;AACAACAG CACACACAGCCAATCC.LjETR1:GCTGATCAGGTAGC GTTG;CATTGCAGAGCCCGAATTGC.LjNRL(Never-ripe like): CACTAGTGCAGATGATGC; GCTGATCCTATCTGAAACC.LjEIN3=TC0031):GGTTCCCTTGGAGAAGGGG;CTTGAGACGCAGTTTATCC.

The 384-well plates were set up using an EppendorfR○epMotionTM5075 Robotics System.Duplicate biological reactions were performed in triplicate with non-template water controls.The qRT-PCR conditions were 95°C for 10 min,followed by 40 cycles of 95°C for 15 sec and 59°C of annealing temperature for 1 min.The specificity of the PCR reaction was measured by adding a dissociation stage of 95°C at the end of the cycle.The relative expression of gene of interest was normalized to the expression level of LjUbiquitin in the respective tissues.

Acknowledgements

Prof.K.Saeki of Nara Women’s University,Japan,for provided providing the Mesorhizobium loti BNO2 strain and Dr.Malcolm Riley,Toowoomba,DPI,QLD for the mycorrhizal fungus Glomus mossae.We also thank Dr.Ning Chen,Mr Tony Hsiao,and Mrs.Dongxu Li for technical assistance.We thank the Australian Research Council for a Centre of Excellence grant,and the University of Queensland Strategic Fund.

Adam DO,Yang SF(1979)Ethylene biosynthesis:Identification of 1-aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of methionine to ethylene.Proc.Natl.Acad.Sci.USA 76,170–174.

Alonso JM,Hirayama T,Roman G,Nourizadeh S,Ecker JR(1999)EIN2,a bifunctional transducer of ethylene and stress responses in Arabidopsis.Science 284,2148–2152.

Alonso JM,Stepanova AN(2004)The ethylene signalling pathway.Science 306,1513–1515.

Beaudoin N,Serizet C,Gosti F,Giraudat J(2000)Interactions between abscissic acid and ethylene signaling cascades.Plant Cell 12,1103–1115.

Bisson MMA,Bleckmann A,Allekotte S,Groth G(2009)EIN2,the central regulator of ethylene signalling,is localized at the ER membrane where it interacts with the ethylene receptor ETR1.Biochem.J.424,1–6.

Biswas B,Chan PK,Gresshoff PM(2009)ABA insensitivity in Lotus japonicus leads to a wilty phenotype but not altered nodulation regulation.Mol.Plant 2,487–499.

Bleecker AB,Estelle MA,Somerville C,Kende H(1988)Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana.Science 241,1086–1089.

Broughton WJ,Dilworth MJ(1971)Control of leghaemoglobin synthesis in snake beans.Biochem.J.125,1075–1080.

Buzas DM,Gresshoff PM(2007)Short-and long-distance control of root development by LjHAR1 during the juvenile stage of Lotus japonicus.J.Plant Physiol.164,452–459.

Caba JM,Recalde L,Ligero F(1998)Nitrate-induced ethylene biosynthesis and the control of nodulation in alfalfa.Plant Cell Environ.21,87–93.

Caba JM,Poveda L,Gresshoff PM,Ligero F(1999)Differential sensitivity of nodulation to ethylene in soybean cv.Bragg and a supernodulating mutant.New Phytol.142,233–242.

Caetano-Anollés G,Gresshoff PM(1991)Plant genetic control of nodulation.Ann.Rev.Microbiol.45,345–382.

Calvert HE,Pence MK,Pierce M,Malik NSA,Bauer WD(1984)Anatomical analysis of the development and distribution of Rhizobium infections in soybean roots.Can.J.Bot.62,2375–2384.

Chang C,Kwok SF,Bleecker AB,Meyerowitz EM(1993)Arabidopsis ethylene-response gene ETR1:Similarity of product to twocomponent regulators.Science 262,539–544.

Clark DG,Gubrium EK,Barrett JE,Nell TA,Klee HJ(1999)Root formation in ethylene-insensitive plants.Plant Physiol.121,53–60.

Delves AC,Mathews A,Day DA,Carter AS,Carroll BJ,Gresshoff PM(1986)Regulation of the soybean-Rhizobium symbiosis by shoot and root factors.Plant Physiol.82,588–590.

Desbrosses GJ,Stougaard,J(2011)Root nodulation:A paradigm for how plant-microbe symbiosis influences host developmental pathways.Cell Host Microbe 10,348–358.

Ecker JR(1995)The ethylene signal transduction pathway in plants.Science 268,667–675.

Fearn JC,LaRue TA(1991)Ethylene inhibitors restore nodulation to sym5 mutants of Pisum sativum L.cv Sparkle.Plant Physiol.96,239–244.

Fernández-López M,Goormachtig S,Gao M,D’Haeze W,Van Montagu M,Holsters M(1998)Ethylene-mediated phenotypic plasticity in root nodule development on Sesbania rostrata.Proc.Natl.Acid.Sci.USA 95,12724–12728.

Fischer RF,Long SR(1992) “Stirring dull roots”:Rhizobium-plant signal exchange.Nature 357,655–660.

Ferguson BJ,Mathesius U(2003)Signaling interactions during nodule development.J.Plant Growth Regul.22,47–72.

Ferguson BJ,Indrasumunar A,Hayashi S,Lin M-H,Lin Y-H,Reid DE,Gresshoff PM(2010)Molecular analysis of legume nodule development and autoregulation.J.Integr.Plant Biol.52,61–76.

Gamborg OL(1970)The effect of amino acids and ammonium on the growth of plant cells in suspension culture.Plant Physiol.45,372–375.

Geurts R,Bisseling T(2002)Rhizobium Nod factor perception and signalling.Plant Cell 14(Suppl),S239–S249.

Ghassemian M,Nambara E,Cutler S,Kawaide H,Kamiya Y,McCourt P(2000)Regulation of abscissic acid signaling by the ethylene response pathway in Arabidopsis.Plant Cell 12,1117–1126.

Goodlass G,Smith KA(1979)Effect of ethylene on root extension and nodulation of pea(Pisum sativum L.)and white clover(Trifolium repens L.).Plant Soil 51,387–395.

Gresshoff PM,Lohar D,Chan PK,Biswas B,Jiang Q,Reid D,Ferguson B,Stacey G(2009)Genetic analysis of ethylene regulation of legume nodulation.Plant Signal.Behav.4,818–823.9.

Grobbelaar N,Clarke B,Hough MC(1971)The nodulation and nitrogen fixation of isolated roots of Phaseolus vulgaris L.III.The effect of carbon dioxide and ethylene.Plant Soil(Special Volume),215–223.

Guinel FC,LaRue TA(1992)Ethylene inhibitors partly restore nodulation to pea mutant E107(brz).Plant Physiol.99,515–518.

Guzman P,Ecker JR(1990)Exploiting the triple response of Arabidopsis to identify ethylene-related mutants.Plant Cell 2,513–523.

Handberg K,Stiller J,Thykj?r T,Stougaard J(1994)Transgenic plants:Agrobacterium-mediated transformation of the diploid legume Lotus japonicus.In:Cells J,ed.Cell Biology:A Laboratory Handbook.Academic Press,London pp.119–125.

Harris JM,Dickstein R(2010)Control of root architecture and nodulation by the LATD/NIP transporter.Plant Signal.Behav.5,1365–1369.

Hayashi M,Miyahara A,Sato S,Kato T,Yoshikawa M,Taketa M,Hayashi M,Pedrosa A,Onda R,Imaizumi-Anraku H,Bachmair A,Sandal N,Stougaard J,Murooka Y,Tabata S,Kawasaki S,Kawaguchi M,Harada K(2001)Construction of a genetic linkage map of the model legume Lotus japonicus using an intraspecific F2 population.DNA Res.8,301–310.

Hayashi S,Reid DE,Lorenc M,Stiller J,Edwards D,Gresshoff PM,Ferguson BJ(2012)Transient Nod-factor-dependent gene expression in the nodulation-competent zone of soybean(Glycine max(L.)).Plant Biotech.J.10,995–1010.

Heidstra R,Yang WC,Yalcin Y,Peck S,Emons A,van Kammen A,Bisseling T(1997)Ethylene provides positional information on cortical cell division but is not involved in Nod factor-induced root hair tip growth in Rhizobium-legume interaction.Development 124,1781–1787.

Hirokawa T,Boon-Chieng S,Mitaku S(1998)SOSUI:Classification and secondary structure prediction system for membrane proteins.Bioinformatics 14,378–379.

Hunter WJ(1993)Ethylene production by root nodules and effect of ethylene on nodulation in Glycine max.Appl.Environ.Microbiol.59,1947–1950.

Hussain AKMA,Jiang Q,Broughton WJ,Gresshoff PM(1999)Lotus japonicus nodulates and fixes nitrogen with the broad host range Rhizobium sp.NGR234.Plant Cell Physiol.40,894–899.

Jiang Q,Gresshoff PM(1997)Classical and molecular genetics of the model legume Lotus japonicus.Mol.Plant Microbe Inter.10,59–68.

Kieber J(1997)The ethylene response pathway in Arabidopsis.Annu.Rev.Plant Physiol.Plant Mol.Biol.48,277–296.

Kirda C,Danso SKA,Zapata F(1989)Temporal water stress effects on nodulation,nitrogen accumulation and growth of soybean.Plant Soil 120,49–55.

Kistner C,Winzer T,Pitzschke A,Mulder L,Sato S,Kaneko T,Tabata S,Sandal N,Stougaard J,Webb KJ,Szczyglowski K,Parniske M(2005)Seven Lotus japonicus genes required for transcriptional reprogramming of the root during fungal and bacterial symbiosis.Plant Cell 17,2217–2229.

Lanahan MB,Yen HC,Giovannoni JJ,Klee HJ(1994)The Never Ripe mutation blocks ethylene perception in tomato.Plant Cell 6,521–530.

Lee KH,La Rue TA(1992)Exogenous ethylene inhibits nodulation of Pisum sativum L.cv Sparkle.Plant Physiol.100,1334–1338.

Libbenga KR,van Iren F,Bogers RJ,Schraag-Lammers MF(1973)The role of hormones and gradients in the initiation of cortex proliferation and nodule formation in Pisum sativum L.Planta 114,675–682.

Ligero F,Poveda JL,Gresshoff PM,Caba JM(1999)Nitrate-and inoculation-enhanced ethylene biosynthesis in soybean roots as a possible mediator of nodulation control.J.Plant Physiol.154,482–488.

Lohar D,Stiller J,Kam J,Stacey G,Gresshoff PM(2009)Ethylene insensitivity conferred by the Arabidopsis Etr1-1 receptor gene alters the nodulation response of transgenic Lotus japonicus.Ann.Bot.104,277–285.

Marino D,Gonzalez EM,Arrese-Igor C(2006)Drought effects on carbon and nitrogen metabolism of pea nodules can be mimicked by paraquat:Evidence for the occurrence of two regulation pathways under oxidative stresses.J.Exp.Bot.57,665–673.

Nishimura R,Ohmori M,Kawaguchi M(2002)The novel symbiotic phenotype of enhanced-nodulating mutant of Lotus japonicus:Astray mutant is an early nodulating mutant with wider nodulation zone.Plant Cell Physiol.43,853–859.

Nukui N,Ezura H,Yuhashi K-I,Yasuta T,Minamisawa K(2000)Effects of ethylene precursor and inhibitors for ethylene biosynthesis and perception on nodulation in Lotus japonicus and Macroptilium atropurpureum.Plant Cell Physiol.41,893–897.

Nukui N,Ezura H,Minamisawa K(2004)Transgenic Lotus japonicus with an ethylene receptor gene Cm-ERS1/H70A enhances formation of infection threads and nodule primordia.Plant Cell Physiol.45,427–435.

Oka-Kira E,Kawaguchi M(2006)Long-distance signaling to control root nodule number.Curr.Opin.Plant Biol.9,496–502.

Oldroyd GE,Engstrom EM,Long SR(2001)Ethylene inhibits the Nod factor signal transduction pathway of Medicago truncatula.Plant Cell 13,1835–1849.

Oldroyd G,Downie JA(2004)Calcium,kinases and nodulation signaling in legumes.Nat.Rev.Mol.Cell Biol.5,566–576.

Penmetsa RV,Cook DR(1997)A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont.Science 257,527–530.

Penmetsa RV,Uribe P,Anderson J,Lichtenzveig J,Gish J-C,Nam YW,Engstrom E,Xu K,Sckisel G,Pereira M,Baek JM,Lopez-Meyer M,Long SR,Harrison MJ,Singh KB,Kiss GB,Cook DR(2008)The Medicago truncatula ortholog of Arabidopsis EIN2,sickle,is a negative regulator of symbiotic and pathogenic microbial associations.Plant J.55,580–595.

Peters NK,Crist-Estes DK(1989)Nodule formation is stimulated by the ethylene inhibitor aminoethoxyvinylglycine.Plant Physiol.91,690–693.

Prayitno J,Rolfe BG,Mathesius U(2006)The ethylene insensitive sickle mutant of Medicago truncatula shows altered auxin transport regulation during nodulation.Plant Physiol.142,168–180.

Prayitno J(2010)Root and nodulation phenotypes of the ethyleneinsensitive sickle mutant of Medicago truncatula.HAYATI J.Biosci.17,131–136.

Schmidt JS,Harper JE,Hoffman TK,Bent AF(1999)Regulation of soybean nodulation independent of ethylene signaling.Plant Physiol.119,951–959.

Searle IR,Men AE,Laniya TS,Buzas DM,Iturbe-Ormaetxe I,Carroll BJ,Gresshoff PM(2003)Long-distance signalling in nodulation directed by a CLAVATA1-like receptor kinase.Science 299,109–112.

Singleton PW,Bohlool BB(1984)Effect of salinity on nodule formation by soybean.Plant Physiol.74,72–76.

Suganuma N,Yamauchi H,Yamamoto K(1995)Enhanced production of ethylene by soybean roots after inoculation with Bradyrhizobium japonicum.Plant Sci.111,163–168.

Vierheilig H,Coughlan A,Wyss U,Piché Y(1998)Ink and vinegar,a simple staining technique for arbuscular-mycorrhizal fungi.Appl.Environ.Microbiol.64,5004–5007.

Wang KL,Li H,Ecker JR(2002)Ethylene biosynthesis and signaling networks.Plant Cell 14(Suppl),S131–151.

Wang Y,Liu C,Li K,Sun F,Hu H,Li X,Zhao Y,Han C,Zhang W,Duan Y,Liu M,Li X(2007)Arabidopsis EIN2 modulates stress response through ABA response pathway as disruption of Ein2 cause substantial increase in ABA.Plant Mol.Biol.64,633–644.

Woeste KE,Ye C,Kieber JJ(1999)Two Arabidopsis mutants that overproduce ethylene are affected in the posttranslational regulation of 1-aminocyclopropane-1-carboxylic acid synthase.Plant Physiol.119,521–529.

Wopereis J,Pajuelo E,Dazzo FB,Jiang Q,Gresshoff PM,De Bruijn FJ,Stougaard J,Szczyglowski K(2000)Short root mutant of Lotus japonicus with a dramatically altered symbiotic phenotype.Plant J.23,97–114.

Xie ZP,Staehelin C,Wiemken A,Boller T(1996)Ethylene responsiveness of soybean cultivars characterized by leaf senescence,chitinase induction and nodulation.J.Plant Physiol.149,690–694.

Yoo S-D,Cho Y,Sheen J(2009)Emerging connections in the ethylene signaling network.Trends Plant Sci.14,270–279.

Yu YB,Adams AD,Yang SF(1979)1-aminocyclopropane-1-carboxylic acid synthase,a key enzyme in ethylene biosynthesis.Arch.Biochem.Biophys.198,280–286.

Zhang F,Dashti N,Hynes RK,Smith DL(1996)Plant growth promoting rhizobacteria and soybean(Glycine max(L.)Merr.)nodulation and nitrogen fixation at suboptimal root zone temperatures.Ann.Bot.77,453–459.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1.Amino acid sequence alignment of L.japonicus EIN2a,EIN2b with AtEIN2(accession identification NP_195948.1),MtSkl1(accession identification ACD84889.1)and GmEIN2-like(XP_003520649.1).

Note the two major amino acid deletions(position 155–192 and 263–324 on the figure’s scale)in the first part of the protein of Lotus.

Figure S2.Colonization of mycorrhizae on MG-20 and enigma-1.

a,arbuscular structure;b,invading hyphae.No visible difference was detected.