Effect of Huoxue Yiqi recipe on proliferation, migration and tube formation of miR-484 overexpressed umbilical vein endothelial cells

YANG Rui, CHENG Xu, ZHAO Meng-zhu, GUO Qian-qian, ZHANG Xin-yue, LIU Menghua, WEI Qiong, ZHANG Dong-mei

Dongzhimen Hospital,Ministry of Education and Beijing Key Laboratory of Traditional Chinese Medicine Internal Medicine,Beijing University of Chinese Medicine,Beijing 100700, China

Keywords:

ABSTRACT Objective: To explore the possible mechanism of Huoxue Yiqi recipe promoting angiogenesis by targeting VEGF with miR-484.Methods: The model of miR-484 overexpressed in HUVEC was prepared and intervened with Huoxue Yiqi Recipe Freeze-dried powder.The effects of Huoxue Yiqi Recipe on proliferation, migration and tubular forming ability of HUVEC were separatly detected by CCK-8 method, cell scratch test and Matrigel three-dimensional forming test in vitro.The effect of Huoxue Yiqi Recipe on VEGFA mRNA expression was detected by real-time fluorescence quantitative PCR.Results: Compared with the control group, the proliferation and migration area of cells in miR-484 overexpression model group decreased, the length, number of branches and nodes involved in tube formation decreased, the tube formation ability decreased significantly, and the expression level of VEGFA mRNA decreased, with statistical significance.Compared with the model group, the cell proliferation ability, migration area, length, number of branches and nodes involved in tube formation, tube formation ability and expression level of VEGFA mRNA in the Huoxue Yiqi Prescription group were upregulated, and the difference was statistically significant (P ＜ 0.05).Conclusion: MiR-484 inhibits the expression of VEGFA and the proliferation, migration and formation of HUVEC,and Huoxue Yiqi recipe has a certain negative regulation effect on this process, which may be a new target of Huoxue Yiqi recipe to promote angiogenesis.

1.Introduction

Therapeutic angiogenesis after acute myocardial infarction is to improve the compensatory ability of myocardial collateral circulation by stimulating the formation of new vascular network on the basis of the original vascular system, so as to improve the symptoms of myocardial ischemia.Angiogenesis is regulated by many factors, among which microRNA ( miRNA ) is a key regulator.MiRNAs are a group of small non-coding RNAs with a length of 21-23 nucleotides, which mainly regulate gene expression at the post-transcriptional level.More and more researchers have found that miRNA can regulate the expression of angiogenesisrelated factors and regulate endothelial cell proliferation, migration and lumen formation[1].Among the numerous miRNAs, miR-484 may be an innovative gene therapy candidate for angiogenesis, and miR-484 can synergistically regulate the expression of vascular endothelial growth factor ( VEGF )-B and VEGF-R2 ( KDR )[2].The VEGF family mainly includes seven subtypes : VEGFA,VEGFB, VEGFC, VEGFD, VEGFE, VEGFF and placental growth factor ( PLGF )[3].Among them, VEGFA is the most important vascular regulator and the most active isoform in angiogenesis[4].Huoxue Yiqi Decoction is a clinical experience prescription for ischemic heart disease, especially coronary heart disease with qi deficiency and blood stasis.Previous studies have shown that Huoxue Yiqi Decoction can directly induce the expression of VEGF and its mRNA in ischemic myocardium[5].Promote angiogenesis in the marginal zone of infarction or down-regulate the expression of miR-126 or Spred1, a negative regulator of VEGFA mRNA,indirectly up-regulate the expression of VEGF and its mRNA, and promote angiogenesis[6,7].In order to clarify the regulatory effect of miR-484 on angiogenesis and further explore the mechanism of promoting angiogenesis by Huoxue Yiqi Recipe, this study was based on the establishment of miR-484 overexpression human umbilical vein endothelial cells ( Human Umbilical Vein Endothelial Cells, HUVEC ) model.Huoxue Yiqi Recipe was intervened to explore the effect of miR-484 on HUVEC proliferation, tube formation and VEGFA mRNA expression and the effect of Huoxue Yiqi Recipe.

2.Materials and methods

2.1 Cells

Human Umbilical Vein Endothelial Cell ( HUVEC ) ( Cat.# :DFSC-EC-01 ) was purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.

2.2 Drugs and main reagents

ECM medium ( Shanghai Zhongqiao Xinzhou Biological Co.,Ltd., Cat.# : 1001 ) ; bovine fibronectin ( Sciencell, Cat.# : O113 ); miR-484 mimics and mimics negative control ( mimics NC ) were synthesized by Shanghai Jima Pharmaceutical Technology Co.,Ltd.; hiPerFect Transfection Reagent ( Qiagen, Cat.# : 301705 ) ;phosphate buffer ( DPBS, Solarbio Technology Co., Ltd., Cat.# :D1040-500 ) ; trypsin / EDTA digestive juice ( ScienCell, Cat.# :0103 ) ; matrigel base gum ( Solarbio Technology Co., Ltd., Cat.#: M8371 ) ; CCK-8 kit ( Japan Tongren Institute of Chemistry, Cat.# : CK04-1 ) ; fastKing RT Kit ( With gDNase ) ( Cat.# : KR116 ),SuperReal PreMix Plus ( SYBR Green ) ( Cat.# : FP205 ), miRcute miRNA Isolation Kit ( Cat.# : DP501 ) MiRcute Plus miRNA First-Strand cDNA Synthesis Kit ( Cat.# : KR211-02 ) and miRcute Plus miRNA qPCR Kit ( Cat.# : FP411-02 ) were purchased from TIANGEN Company.Huoxue Yiqi Recipe ( astragalus 60 g, dangshen 60 g, salvia miltiorrhiza 10 g, chuanxiong 10 g, red peony root 10 g, safflower 10 g ), all drugs by Beijing university of Chinese medicine dongzhimen hospital to provide decoction pieces,decoction, filtration, concentration, water control within 3 %.The concentrated solution was kept overnight at -40 ℃.After the liquid was completely condensed, it was placed in a freeze-dryer for one day.The water was removed by low-temperature sublimation, and the freeze-dried powder of Huoxue Yiqi Recipe was collected for use.

2.3 Construction of miR-484 overexpression HUVEC cell model

HUVECs in logarithmic growth phase were collected and made into 5 × 104cells/ml cell suspension.HUVECs were seeded in 96-well plates coated with bovine fibronectin 2 μg/cm2in advance according to 100 μL/well, and incubated in the incubator for 24 h to make cells adhere.The miR-484 mimics/mimics NC dry powder was centrifuged and DEPC water was added to configure a working solution of 20 μM ; the 2 μL miR-484 mimics/mimics NC working solution was added to 50 μL basic ECM medium without fetal bovine serum, growth factor and double antibody, mixed well, and then added 0.75 μL HiPerFect Transfection Reagent, mixed well,incubated at room temperature for 5-10 min to form a transfection mixture.The old medium was discarded, and 150 μL of basic ECM medium was added to each well, and then the transfection mixture was added.After 6 hours of transfection in the incubator,the complete ECM medium supplemented with fetal bovine serum,growth factor and double antibody was added to continue to culture for 48 hours.The cell models of miR-484 overexpression ( miR-484 mimics ) group and negative control ( Mimics NC ) group were established.The expression of miR-484 in HUVEC was detected by real-time fluorescence quantitative PCR to evaluate whether the model was successfully constructed.

2.4 Grouping and administration

After the establishment of miR-484 overexpression HUVEC model, the cells were divided into control group ( Mimics NC group), model group ( miR-484 mimics group ) and drug group ( miR-484 mimics + Huoxue Yiqi Decoction lyophilized powder solution group ).The drug group was added to the ECM medium containing 2 mg/ml Huoxue Yiqi Decoction lyophilized powder, and the control group and the model group were added to the same amount of ECM medium.

2.5 CCK-8 method was used to detect the proliferation of hypoxic HUVEC

The cells were evenly inoculated in a 96-well plate at 5 × 104cells/well.After modeling and intervention according to the method described in 1.4, the supernatant was discarded and mixed according to the ratio of CCK-8 solution : basic ECM medium = 1 : 10.The cells were added to 110 μl/well and incubated in an incubator for 3 h.The absorbance value ( OD value ) of each group at 450 nm wavelength was measured by a multifunctional microplate detector.

2.6 Cell scratch test to detect the migration of hypoxic HUVEC

The cells were evenly inoculated in a well-coated 6-well plate at 5 × 104cells/ml ( marking lines were drawn at the bottom of the 6-well plate so that three parallel lines passed through each well ).According to the method described in 1.4 modeling and grouping.When the cells were fused into a piece and there was no large cell gap, a 200 μL gunhead was perpendicular to the marker line to draw a line at the bottom.After removing the scratched and apoptotic cells by DPBS washing, the basic ECM medium was replaced.The photos were taken under the inverted microscope at 0 h and xh, respectively.The location of each photo was marked with a marked line in advance as the positioning point to ensure the same position for comparison.The scratch area between the two photos was statistically analyzed using Image J software.The mobility ( %) was calculated as follows : mobility ( % ) = ( A0-AX ) / A0 × 100%, where A0 represents the initial wound area ( t = 0 h ), and AX represents the residual area point during measurement ( t = xh ).

2.7 Matrigel assay was used to detect the tube formation ability of hypoxic HUVEC

The Matrigel matrix was spread in a pre-cooled 96-well plate at a rate of 50 μL/well, and incubated in an incubator for 30 min to coagulate.According to the method described in 1.4 modeling and grouping.After trypsin digestion, the cell suspension of each group was collected, centrifuged and resuspended with basic ECM medium.The cells were seeded in a 96-well plate containing solidified Matrigel matrix at a concentration of 2 × 105cells/ml, 100 μL per well, and incubated in an incubator for 6 h.The HUVEC tube formation was observed under an inverted microscope and photographed.Image J software was used for statistical analysis.

2.8 The expression of VEGFA mRNA was detected by realtime PCR

Take 2 μg total RNA extracted, according to the reverse transcription kit instructions : 5 × Buffer 2 μL, RNase-freewater,configure 10 μL gDNA removal reaction system mixture, reaction at 42 ℃ for 3 min ; the mixture of RT-Mix 1 μL, 10 × Buffer 2μL, FQRT Primer Mix 2μL and RNase-freewater 5μL was configured to reverse transcription reaction system, and reverse transcription was performed at 42 ℃ for 15 min and 95 ℃ for 3 min to obtain cDNA strand.Using cDNA as a template for PCR reaction, according to the fluorescence quantitative kit instructions : 2 Pre Mix 10 μL,10nmol / l upstream and downstream primers each 0.6 μL, cDNA 2 μL, RNase-free water 6.4 μL, 50 × Dye 0.4 μL, configuration 20 μL of the reaction system, into the PCR instrument, 95 ℃ 15 min activation FastStart DNA Taq polymerase, 95 ℃ 10 s, 60 ℃32 s, 40 cycles, real-time fluorescence quantitative PCR.Then the PCR dissolution curve was detected.GAPDH was used as internal reference.Primers were designed with NCBI PrimeR-BLAST and synthesized by Sangon Biotech Co., Ltd.Primer sequence ( 5‘ - 3 ‘ ) : VEGFA, upstream : CTGTCTTGGGTGCATTGGAG,downstream : ACCAGGGTCTCGATTGGATG ; gAPDH ,upstream: GGGTGTGAACCATGAGAAGT , Downstream :GACTGTGGTCATGAGTCCT.Three duplicate wells were set up for each sample, and the mean value was taken.The obtained CT value was homogenized according to the 2-△△ctmethod and then statistically analyzed.

2.9 Statistical methods

SPSS 22.0 statistical software was used.The measurement data were expressed as mean ± standard deviation (±s ), and the two groups were compared with independent sample t test.One-way ANOVA was used when the variance of multiple groups was equal,and welch test was used when the variance was not equal.LSD test was used when the variance was equal, and Dunnett ‘s T3 test was used when the variance was not equal.Non-parametric test was used for those who did not obey the normal distribution, and P ＜ 0.05 was considered statistically significant.

3.Results

3.1 Evaluation of miR-484 overexpression HUVEC cell model by real-time fluorescence quantitative PCR

As shown in Table 1, compared with the Mimics NC group,the expression of miR-484 in the miR-484 mimics group was significantly increased ( P ＜ 0.01 ).The miR-484 overexpression HUVEC cell model was successfully constructed.

Tab 1 Expression of miR-484 in HUVEC in each group ( ±s )

Tab 1 Expression of miR-484 in HUVEC in each group ( ±s )

Note : * Compared with Mimics NC group, P ＜ 0.01.

Group n Relative expression of miR-484 Mimics NC 3 1.003±0.092 miR-484 mimics 3 140.341±20.068*t 12.026 P 0.007

3.2 HUVEC proliferation in each group

Compared with the control group ( Mimics NC group ), the proliferation of HUVEC in the model group ( miR-484 mimics group ) decreased ( P ＜ 0.01 ) ; compared with the model group,the proliferation of HUVEC in the drug group ( miR-484 mimics +Huoxue Yiqi Decoction lyophilized powder solution group ) was upregulated ( P ＜ 0.01 ).See Table 2 for details.

Tab 2 HUVEC proliferation in each group ( ±s )

Tab 2 HUVEC proliferation in each group ( ±s )

Note : * Compared with the control group, P ＜ 0.01 ; ** Compared with the model group, P ＜ 0.01.

Group n OD value Control group 8 0.534±0.039 Model group 8 0.485±0.011*Drug group 8 0.561±0.042**F 10.356 P 0.001

3.3 HUVEC migration in each group

Compared with the control group, the migration area of HUVEC in the model group decreased ( P ＜ 0.05 ) ; compared with the model group, the migration area of HUVEC in the drug group increased (P ＜ 0.05 ).Compared with the control group, the migration rate of HUVEC in the model group decreased.Compared with the model group, the migration rate of HUVEC in the drug group showed a downward trend, but the difference was not statistically significant (P ＞ 0.05 ).

Tab 3 HUVEC migration in each group ( ±s )

Tab 3 HUVEC migration in each group ( ±s )

Note : * Compared with the control group, P ＜ 0.05 ; ** Compared with the model group, P ＜ 0.05.

Group n Cell migration area(μm2) cell migration rate(%)Control group 3 15713666.85±810625.50 37.9±2.3 Model group 3 10806475.68±866937.12* 28.81±7.5 Drug group 3 15472260.32±3839918.07** 27.0±6.4 F 4.265 3.000 P 0.010 0.125

3.4 HUVEC tube formation in each group

Compared with the control group, the length, branch number and node number of HUVEC participating in tube formation in the model group decreased, and the tube formation ability decreased significantly ( P ＜ 0.01 ).Compared with the model group, the length, branch number and node number of HUVEC participating in tube formation in the drug group increased, and the tube formation ability was significantly improved ( P ＜ 0.05 ).See Table 4, Figure 2.

3.5 Expression of VEGFA mRNA in each group

Compared with the control group, the expression level of VEGFA mRNA in the model group was down-regulated ( P ＜ 0.05 ) ;compared with the model group, the expression level of VEGFA mRNA in the drug group was up-regulated ( P ＜ 0.01 ).See Table 5.

Tab 4 HUVEC tube formation in each group ( ±s )

Tab 4 HUVEC tube formation in each group ( ±s )

Note : * Compared with the control group, P ＜ 0.01 ; ** Compared with the model group, P ＜ 0.05.

Group n Branching length (μm) Branches（個(gè)） Nodes（個(gè)）Control group 4 384021.23±43246.07 513±71.754 5829±606.671 Model group 4 84264.70±6782.77* 231.753±17.727* 855.753±75.571*Drug group 4 320800.61±38718.22** 548±43.259** 4710.5±718.509**F 87.722 49.178 91.781 P 0.000 0.000 0.000

Fig 2 HUVEC tube formation in each group ( 100 × )

Tab 5 Expression of VEGFA mRNA in each group ( ±s )

Tab 5 Expression of VEGFA mRNA in each group ( ±s )

Note : * Compared with the control group, P ＜ 0.05 ; ** Compared with the model group, P ＜ 0.01.

Group n VEGFA mRNA Control group 3 1.016±0.336 Model group 3 0.522±0.120*Drug group 3 1.327±0.268**F 11.247 P 0.009

4.Discussion

Acute myocardial infarction belongs to the category of ‘ chest obstruction ‘ and ‘ true heart pain ‘ in traditional Chinese medicine.Due to the sudden obstruction of the vein, the blood cannot nourish the myocardium.Therefore, in the early stage of myocardial infarction, blood stasis is the main injury, and the blood cannot be nourished around the usual way.Over time, the heart lost nourishment and the heart-energy deficiency is caused.If the heart-energy is insufficient, the blood circulation is weaker, and the blood flow is slow and easy to be blocked into stasis.In the theory of ‘ blood syndrome ‘, ‘ all blood syndrome must first to remove blood stasis ‘, blood stasis does not go, new blood does not produce, ‘ removing blood stasis ‘ is the premise of ‘ generating new‘, and ‘ generating new ‘ includes both generating new blood and generating new blood vessels[8] ; the growth of all things depends on the adequacy of qi.If qi deficiency is not supplemented, it is unable to germinate.Qi is the handsome of blood, strong qi leads to unobstructed blood flow, blood is the mother of qi, blood is sufficient, qi is sufficient, blood deficiency, germinal force will lose its source, qi and blood are mutually rooted and complement each other.Many scholars believe that ‘ heart qi deficiency syndrome ‘is related to myocardial energy metabolism disorders.Tonifying qi can improve energy metabolism, accelerate the removal of blood stasis and the formation of new blood[9,10].It can be seen that Yiqi Huoxue method plays an important role in the angiogenesis stage after myocardial infarction.Modern studies have confirmed that Yiqi Huoxue Chinese medicine can directly act on endothelial cells and significantly promote angiogenesis by promoting proliferation,inhibiting apoptosis or up-regulating VEGF expression.Huoxue Yiqi Decoction is a combination of Astragalus membranaceus[11],Codonopsis pilosula, Salvia miltiorrhiza[12,13], Radix Paeoniae Rubra, Safflower and Chuanxiong[14] in one prescription, which can replenish qi and activate blood, remove blood stasis and generate new blood.In the previous research results of our research group,it was found that Huoxue Yiqi Decoction can act on various related links of angiogenesis through multi-target and multi-channel ways, promote the proliferation, migration and tube formation of endothelial cells after hypoxia, and promote angiogenesis.And 2 mg/ml Huoxue Yiqi Decoction lyophilized powder solution significantly increased cell viability.

Studies have shown that miRNAs can directly target pro-angiogenic factors or their upstream factors.For example, miR-195[15] and miR-150[16] can directly bind to the 3’UTR of VEGF mRNA and inhibit its expression, thereby inhibiting angiogenesis ; it can also negatively regulate VEGF signaling pathway by targeting the downstream of VEGF, such as miR-23, miR-132, miR-221 to promote angiogenesis[17].Because the action mode of miRNA is multi-target and multipathway, it may target multiple mRNAs at the same time.There are two trends in the regulation of angiogenesis by some miRNAs.For example, miR-126, which is specifically expressed in endothelial cells, can not only inhibit the expression of VEGF and thus inhibit angiogenesis[18], but also target the expression of negative regulatory factors of VEGF and play a synergistic role in the process of angiogenesis[19].Previous studies have found that miR-484 is significantly differentially expressed in patients with ischemic heart disease and tumor disease / experimental models, and its differential expression may affect angiogenesis[20,21].LI et al.[22] confirmed that miR-484 can inhibit angiogenesis in gastric cancer tissues, and in another study, miR-484 may have a synergistic effect with antiangiogenic drugs[23].In this study, 2 mg/ml Huoxue Yiqi Decoction lyophilized powder solution was continued to intervene in miR-484 overexpressed HUVEC cell model.The results showed that Huoxue Yiqi Recipe could reduce the inhibitory effect of overexpression of miR-484 on the proliferation, migration and tube formation of endothelial cells, indicating that Huoxue Yiqi Recipe had a certain negative regulatory effect on the process of miR-484 targeting VEGFA to inhibit angiogenesis, and could improve the inhibitory effect of miR-484 on VEGFA mRNA expression, thereby promoting VEGFA expression and promoting angiogenesis.

VEGFA mainly transmits signals by binding to three tyrosine kinase receptors ( VEGFR1, VEGFR2, VEGFR3 ) and two non-tyrosine kinase transmembrane receptors ( NP-1, NP-2 ).VEGFR2 ( Flk-1/KDR ) is the main VEGF signal transduction receptor that promotes the proliferation, migration and mitosis of vascular endothelial cells[24].It can regulate the proliferation of vascular endothelial cells through downstream PLCγ/Ca2+and MAPK signaling pathways,regulate the migration of vascular endothelial cells through Src and FAK signaling pathways, and regulate the survival of endothelial cells through PI3K/Akt signaling pathway.MiR-484 targeting VEGFA to inhibit angiogenesis may be related to these signaling pathways[25].

In summary, Huoxue Yiqi Recipe can promote HUVEC proliferation, migration and tube formation.The mechanism may be related to the reduction of miR-484 on HUVEC proliferation,migration, tube formation and VEGFA mRNA expression, which may be one of the mechanisms of Huoxue Yiqi Recipe promoting angiogenesis.However, the relationship between the expression of miR-484 and the proliferation, migration and tube formation of HUVEC and whether Huoxue Yiqi Decoction directly inhibits miR-484 is not very clear.Our research group will further verify the molecular mechanism of Huoxue Yiqi Recipe regulating angiogenesis after myocardial infarction through miR-484 in future experiments.

The author ‘s contribution

Zhang Dongmei : responsible for experimental design,experimental guidance and article review ; Zhao Mengzhu, Guo Qianqian : Provide technical guidance for the experiment ; Yang Rui,Cheng Xu, Zhang Xinyue, Liu Menghua, Wei Qiong is responsible for experimental implementation, index detection and data analysis ;Yang Rui, Cheng Xu : write articles.All authors declare that there is no conflict of interest.