METTL14 upregulates m6A modification of pri-miR-141 inhibiting ZEB1 to promote proliferation and inflammation of lung fibroblasts

YANG Yi-xiu, CHEN Jie, LI Quan-ni, LIN Mei, DING Yi-peng

1.Hainan Hospital Affiliated to Hainan Medical University, Haikou 570311, China

Keywords:

ABSTRACT

1.Introduction

Chronic obstructive pulmonary disease (COPD) is a major and growing cause of death worldwide, characterized by a combination of airway disease and emphysema [1,2].One of the potential features of the development of COPD is abnormal tissue repair and remodeling, leading to disturbances in extracellular matrix homeostasis[3].Dysfunction of lung fibroblasts may be key to this abnormal tissue repair and remodeling [4].

miRNAs are endogenous noncoding RNAs with a length of 19-25 nucleotides that negatively regulate gene protein expression[5].Our group found that miR-141 is highly expressed in COPD, which promotes lung fibroblast proliferation and inhibits apoptosis by targeted inhibition of ZEB1[6].However, the upstream regulation mechanism of high expression has not been fully clarified.Currently, more than 100 RNA modifications have been reported[7], of which N6 methyladenosine (m6A) modification is the most common internal modification in eukaryotic messenger RNAs(mRNAs) [8].In mammals, methyltransferase-like 3/4 (METTL3/4)and Wilm tumor-associated protein (WTAP) are responsible for catalyzing the formation of m6A modifications [9].The study confirmed that METTL14 can participate in tumor progression by regulating m6A modification sites on miRNAs [10,11], but the function and mechanism of METTL14 regulation in fibroblasts have not been reported.According to database predictions, we found that pri-miR-141 has an M6A modification site.Therefore, this study intends to investigate the stability of METTL14 by regulating the m6A modification of pri-miR-141 The expression of miR-141,thereby participating in regulating the progression of COPD, and providing a new way to explore the pathogenesis of COPD.

2.Materials and methods

2.1 Experimental reagents and instruments

DMEM medium (11965092), fetal bovine serum FBS (30044333),pancreatic enzyme (25200-072 Penicillin/streptomycin (15070063)purchased from Gibco; The reverse transcription kit (P312) and realtime PCR (Q331) were purchased from Nanjing Novazan Biologics;RNA Immuno-precipitation Kit (RIP-12RXN) purchased from Sigma-Aldrich; Flow cytometry apoptosis assay kit (A23202) was purchased from ThermoFisher; ELISA kits for human interleukin 2 (IL-2), interleukin 6 (IL-6) and human tumor necrosis factor(TNF-α) were purchased from Shanghai Renjie Biologics; CCK8 reagent was purchased from MedChemExpriss; Trizol reagent(15596026) was purchased from Guangzhou Jiheng Pharmaceutical;METTL14(ab300104)、ZEB1(ab203829), m6A (ab 151230) and GAPDH (ab181602) that primary antibodies were purchased from Abcam; HRP-sheep anti-rabbit IgG (BA1054) was purchased from Baode Biotechnology; pcDNA3.1-METTL14 overexpression plasmid and negative control (NC) were purchased from Shanghai Hanheng Biologics.Lung fibroblasts MRC-5 were purchased from the cell bank of the Institute of Shanghai Academy of Biological Sciences.

2.2 Experimental methods

2.2.1 Fibroblast culture and transfection

Fibroblasts MRC-5 were cultured using DMEM complete medium containing 10% fetal bovine serum, 100 mg/L penicillin, and streptomycin, placed at 37.5 ℃ in a cell culture incubator containing 5% CO2.When MRC-5 is in the logarithmic growth phase,MRC-5 cells are digested by trypsin, a cell suspension is made,and seeded in 6-well plates for subsequent experiments.MRC-5 cells were transfected with METTL14 overexpressed plasmid and unloaded plasmid, cultured for 24 h and then performed subsequent experiments.

2.2.2 qPCR detection

The transfected MRC-5 cells were extracted using Trizol reagent,and the extraction was evaluated with NanoDrop 2 000 (Thermo Fisher Fisher, USA).Concentration and purity of RNA.RNA was reverse-transcribed to cDNA using a reverse transcription kit and a q PCR reaction was performed on the ABI 7500QPCR instrument under the conditions of 95 ℃ pre-denaturation for 5 min, 95 ℃denaturations for 5 sec, 62 ℃ renaturations for 20 sec, 72 ℃extensions for 30 sec, 40 cycles.Using the GAPDH gene as the internal reference, METTL14 and Z were calculated by the 2-ΔΔctmethod The expression of EB1.METTL14 Upstream Primers:AGAAACTTGCAGGCTTCCT, METTL14 Downstream Primers:TCTTCTTCATATGGCAAATTTTCT; ZEB1 upstream primers:ACCCTTGAAGTGATCCAGC; ZEB1 downstream primers:CATTCCATTTTCTGTCTTCCGC; GAPDH upstream primers:ATGGTTTACATGTTCCAATATGATT; Downstream primers:AATCATATTGGAACATGTAAACCAT; pri-miR-141 Upstream primers: CGGCCGGCCCUGGGUCCAUCUUCCA; miR-141 upstream primers: GCGAAGCATTTGCCAAGAA; miRNA universal downstream primers: CAATCACAGACCTGTTATTGC;U6 upstream primer: CTCGCTTCGGGCAGCACA, downstream primer: AACGCTTCACGAATTTGCGT.The primers were synthesized by Guangzhou Anenor Biotechnology Co., Ltd.

2.2.3 Western blot detects METTL14 and ZEB1 expression levels in MRC-5

The total protein in MRC-5 cells was extracted using RIPA lysate with protease and phosphatase inhibitors, the protein sample concentration and purity were determined using BCA, followed by loading, electrophoresis, and PVDF membrane transfer Operation,adding diluted METTL14, ZEB1, GAPDH primary antibody was incubated overnight at 4 C for the next day After TBST washed the PVDF membrane, the sheep anti-rabbit IgG secondary antibody was added, incubated at 37 ℃ for 1 h, ECL color was developed, the dark room was exposed, photographed and grayscale analyzed by the image.

2.2.4CCK8 detects MRC-5 cell proliferation

MRC-5 cells from the logarithmic growth phase METTL14 overexpressed and negative control groups were seeded in 96-well plates at a density of 1 000 pcs/well.On days 1, 2, 3, 4, and 5 of coculture, add 10 μL volumes of CCK8 solution per well, respectively,and incubate in an incubator for 2 h to detect the wavelength at OD450 in a multifunctional microplate reader.

2.2.5 Flow cytometry to detect apoptosis of MRC-5 cells

Digest the cells to be tested using trypsin without EDTA, centrifuge at 2 000 rpm at room temperature for 5 min, and discard the supernatant.PBS resuspend the cells, transfer to a 1.5 mL EP tube,centrifuge again and discard the supernatant.Cell count 2 106 cells per group and resuspend using 200 μL buffer.All experimental groups were double-stained with negative controls, with 5 μL Annexin V and 5 μL 7-AAD dyes added.The positive control set up two dye mono stain tubes, add 5 μL Annexin V or 5 μL 7-AAD dye and incubate for 15 min protected from light.At the end of staining,1 mL PBS was added, centrifugation discarded supernatant, 100 mL PBS was added to resuspend, and the 200 mesh filter was tested on the machine.

2.2.6 ELISA kit assay

Remove the kit 30 min in advance and equilibrate to room temperature.Collect the supernatant of the cells to be tested, and add 100 μL of the standard to the standard; Add 100 μL of distilled water to the blank control well; Add 100 μL of cell supernatant to the remaining wells and read the OD values of each well at 450 nm according to the ELISA kit instructions.

2.2.7 meRIP-qPCR detection

Extract total RNA from METTL14 overexpression and control MRC-5 cells using the NEB Next Poly(A) mRNA Magnetic Isolation Kit (New England Biolabs, UK) for polymerization (A)+RNA purification and fragmentation.Evaluate the concentration and purity of extracted RNA with NanoDrop 2 000.Dynabeads Protein A was mixed with rabbit anti-m6A antibody and incubated at 4 ℃for 2 h, then mRNA fragments were incubated with the mixture for another 2 h to precipitate m6A The enriched RNA was detected by qPCR to detect the expression of pri-miR-141 in the precipitate.

2.2.8 RNA immunoprecipitation (RIP) detects the binding of METTL14 to pri-miR-141

Perform RIP experiments in MRC-5 cells of METTL14 overexpression and control groups, following the RNA Immunoprecipitation kit instructions.Briefly, 4 μg of lgG,METTL14 antibody and cell lysate are incubated overnight at 4 C by spinning, then spinning to add 20 μL of washed magnetic beads to each reaction and incubating at 4 ℃ for 2 h.After 6 washes, the expression of pri-miR-141 in the immunoprecipitate was detected using qPCR.

2.2.9 Statistical processing

Data analysis was expressed by mean plus or minus standard deviation (), SPSS 20.0 software was used for intergroup analysis, and t-test was used.P＜0.05 was statistically significant.

3.Results

3.1 Successful construction of METTL14 overexpression cells

After overexpressing lentiviral transfection into fibroblast MRC-5 using METTL14, the expression of METTL14 was detected by qPCR.The results showed that the METTL14 levels in the transfection group (4.12±0.19) were significantly higher than those in the control group (1.10±0.07) (see Figure 1A, t=25.62, P＜0.001).The protein expression of METTL14 was detected using Western blot, and the results showed that the transfection group (0.80±0.03).METTL14 was significantly higher at protein levels than in the control group (0.34±0.02) (see Figure 1B,C, t=20.66, P＜0.001).

Fig1 Lung fibroblast proliferation and inflammatory cytokine release promoted by METTL14

3.2 METTL14 promotes fibroblast proliferation and inhibits their apoptosis

The results of CCK8 showed that compared with the control group,the METTL14 gene group (2.15±0.08) was highly expressed The OD450 value of cell viability of MRC-5 cells was significantly higher than that of the control group (1.26±0.05) (See Figure 1D,t=20.00, P＜0.001).Flow cytometry showed apoptosis in MRC-5 cells with high expression of METTL14 genome (8.35%±0.64%) is decreased significantly relative to the apoptosis rate of the control group (10.75%±0.34%) (see Figures 1E, F, t=5.69, P＜0.001).This suggests that METTL14 promotes the proliferative behavior of fibroblasts.

3.3 METTL14 promotes the release of inflammatory factors in fibroblasts

The results of ELISA showed that the pro-inflammatory factor IL-2 (109.51±4.22 pg) in the supernatant of MRC-5 cells with high expression of METTL14 was compared with the control group /mL)、IL-6(67.01±2.57 pg/mL) and TNF-α (176.19±3.01 pg/mL)were significantly higher than IL-2 in the control group 17.03±2.84 pg/mL,t=31.51,P ＜ 0.001), IL-6 (11.86± 3.17 pg/mL, t=23.38,P ＜ 0.001 ) and TNF-α (76.37±0.55 pg/mL, t=56.41, P＜0.001)(see Figure 1G).This suggests that high expression of METTL14 promotes the release of inflammatory factors by fibroblasts.

3.4 METTL14 adds the m6A modification of pri-miR-141

Using database predictions, it was found that the precursor of miR-141, pri-miR-141, has an m6A binding site.To confirm the modification of the m6A locus on miR-141, we used meRIP to detect pri-miR- M6A methylation modification of 141.The results showed that pri-miR-141 in m6A group compared with the IgG group (1.03±0.09).The enrichment relative expression of mRNA(13.55±1.16) was significantly increased, suggesting pri-miR-141 With m6A modification site (see Figure 2A, t=18.64, P＜0.001).Further detection of IP showed that the relative negative carrier enriched the IgG control group (1.12±0.13).The relative expression of pri-miR-141 enriched in the METTL14 antibody group(5.43±0.30) was significantly increased (see Figure 2B, t=22.91,P＜0.001), suggesting that pri-miR-141 can bind directly METTL14.qPCR detection showed that the relative expression of miR-141(3.44±0.20) in METTL14 overexpression group was significantly higher than that in the negative control group (1.12±0.15) (see Figure 2C, t=16.05, P＜0.001).The above results suggest that METTL14 and m6A both bind to the miR-141 precursor and may pass METTL14 promotes m6A modification on pri-miR-141, promoting miR-141 expression.

Fig2 METTL14 inhibited ZEB1 exprission by increasing the m6A modification of miR-141

3.5 METTL14 inhibits ZEB1 expression

Previous studies in our group found that miR-141 targeted inhibition of ZEB1 promotes the proliferation of lung fibroblasts and inhibits apoptosis [6].To find out whether METTL14 regulates the biological behavior of fibroblasts by influencing ZEB1, we used qPCR and Western blot Detection of ZEB1 expression.The results showed that ZEB1 mRNA in the METTL14 overexpressed group in the relatively negative vector control group (1.11±0.14).The relative expression (0.31±0.03) was significantly downregulated (see Figure 2D, t=9.33, P＜0.001); Adopt western blot detected ZEB1 protein expression and showed compared with the negative control group(0.35±0.02), the relative expression of ZEB1 protein in METTL14 overexpression group (0.15±0.02) was significantly decreased (see Fig.2E, F, t=9.90, P＜0.001).These results suggest that METTL14 inhibits ZEB1 expression by increasing m6A modification of miR-141.

4.Discussion

COPD is chronic bronchitis characterized by airflow obstruction that progresses to a common chronic condition of cor pulmonale and respiratory failure [12].Due to the aging of the population and the high smoking rate, the disability rate and case fatality rate of COPD are very high, and the global incidence of over 40 years old has been as high as 9%～10%, which has brought a heavy economic burden to individuals and society [13].Current treatments are not able to completely prevent the progression of the disease in patients with COPD, so further exploration of the molecular mechanisms of COPD development is important for understanding the pathological process of COPD and the search for possible therapeutic targets for intervention are of great significance.

Pulmonary fibroblasts are the primary cells that control extracellular matrix homeostasis by producing extracellular matrix proteins, matrix metalloproteinases, and matrix metalloproteinase tissue inhibitors, and are key to abnormal tissue repair and remodeling of the underlying features of COPD [14].In recent years, with the continuous study of COPD, fibroblasts and related cytokines have been found to be involved in COPD[15].Therefore,studying the involvement of fibroblasts in the pathogenesis of COPD inflammation by fibroblasts secreting related cytokines can provide therapeutic ideas.

Micro-RNAs (miRNAs) are small endogenous noncoding RNAs(19-25 nucleotides) that negatively regulate gene protein expression[5].Recent studies have shown that noncoding RNAs, especially miRNAs, are associated with the occurrence and development of COPD and may be used as biomarkers for COPD diagnosis,treatment, and prognosis [16-18].A large number of studies have shown that miR-141 plays an important regulatory role in the initiation and progression of a variety of tumors.miR-141-3p regulation promotes gastric cancer and nasopharyngeal cancer by regulating different target genes.Proliferation and migration of tumors such as colorectal cancer [19-21].Highly expressed miR-141-5p inhibits BTG1 and promotes cervical cancer progression[22].Low-expression miR-141 targets activation of STAT4 to promote proliferation and metastasis of hepatoma cells [23], and miR-141 has been shown to be able Potential biomarker as target for the diagnosis,prognosis, and treatment of gallbladder cancer [24].Previous studies in our group showed that miR-141 is highly expressed in COPD,which promotes the proliferation of lung fibroblasts by targeted inhibition of ZEB1 and inhibits its Apoptosis [6].However, the upstream regulatory mechanism of MIR-141 high expression is still unclear.

m6A modification mainly exerts its biological function in tissue development, regulating stem cell differentiation, embryonic development, DNA damage, circadian cycle, spermatogenesis,etc[25].m6A modification involves almost all aspects of RNA metabolism, and based on the localization of methyltransferases and demethylases, m6A can be introduced or removed in the nucleus or cytoplasm.Stabilizing pri-miRNA and promoting its cleavage is one of the classic functions of m6A [26].Recent studies have found that m6A modification plays a key role in malignancy progression [27,28].As a key m6A methyltransferase, METTL14 has been reported to play an important role in tumor initiation and progression in hepatocellular carcinoma, bladder, and pancreatic cancer by regulating different target genes [29-31].However, the role of METTL14 in COPD and related mechanisms have not been reported.In this study, we found that high expression of METTL14 promotes the proliferation of fibroblasts and inhibits their apoptosis,promoting the expression of inflammatory factors IL-2, IL-6 and TNF-α.This suggests that METTL14 may be involved in COPD progression by regulating fibroblast activity and related cytokines.

In addition, METTL14 has been reported to be involved in the regulation of m6A site modification of pri-miRNAs.METTL14 promotes cardiovascular endothelial cell proliferation and invasion by increasing them6A methylation modification site of pri-miR-19a [11], promotes migration and invasion of breast cancer cells by regulating m6A modification and miR-146a-5p[10], by increasing the m6A modification site of pri-miR-126 inhibits the metastatic potential of hepatocellular carcinoma[30].The database predicts that we found that the precursor of miR-141, pri-miR-141, has an m6A modification site.Therefore, we speculate that METTL14 could regulate m6A on pri-miR-141 modification sites involved in COPD progression.In this study, we confirmed the presence of m6A modification sites on pri-miR-141 through meRIP experiments, IP and qPCR experiments proved that METTL14 can target binding to pri-miR-141 and increase the expression of miR-141.This suggests that METTL14 may have increased the m6A of pri-miR-141 The modification site stabilizes the expression of miR-141, thereby participating in the regulation of fibroblast proliferation and secretion of inflammatory factors.

The transcription factor ZEB1 belongs to the zinc finger homologous family and functions by binding to the E-box sequence of the downstream target gene promoter region through the zinc finger structure [32].ZEB1 has been shown to be abnormally expressed in a variety of tumors to promote tumor cell migration,invasion and metastasis, and is strongly associated with poor prognosis or low survival rate of cancer [33].Our previous studies have shown that miR-141 promotes lung fibroblast proliferation and inhibits apoptosis by targeted inhibition of ZEB1[6].In this study,we found that high expression of METTL14 significantly inhibits the expression of ZEB1 at the mRNA and protein levels, indicating that METTL14 regulates the mi R-141/ZEB1 axis and is involved in regulating tumor progression.

Our data show that METTL14 participates in promotion by stabilizing miR-141 expression by increasing the m6A modification site of pri-miR-141, thereby inhibiting ZEB1 Proliferation of fibroblasts and secretion of inflammatory factors, which may be key mechanisms for COPD progression.The elucidating mechanism of METTL14 regulating fibroblast proliferation and secretion of inflammatory factors helps understand the pathological process of COPD and find possible therapeutic targets.

Author’s contribution:

Yang Yi-xiu: experimental design and writing; Chen Jie: Carrier construction and verification; Li Quan-ni: Cell culture, transfection and detection; Lin Mei: Data analysis and mapping; Ding Yi-peng:Experimental guidance and revision.

All authors declare no conflict of interest.