Dynamic changes of autophagy during hypertrophic scar formation and the role of autophagy intervention

Yu Liu ,Xiaoxia Chn ,Yuan Fan ,Yu Yan ,Bin H ,Junlin Liao ,K Cao,Xi Zhan,Siwi Qu,*,Jiana Zhou,*

a Postdoctoral Research Station of Clinical Medicine & Department of Plastic Surgery,The Third Xiangya Hospital,Central South University,Changsha 410013,Hunan,China

b Inner Mongolia Medical University,Hohhot 010000,Inner Mongolia,China

c Department of Plastic Surgery,People’s Hospital of Ningxiang,Hunan University of Chinese Medicine,Ningxiang 410600,Hunan,China

d Department of Plastic Surgery,The Third Xiangya Hospital,Central South University,Changsha 410013,Hunan,China

e Department of Plastic Surgery,The First Affiliated Hospital of University of South China,Hengyang 421001,Hunan,China

f Department of Oncology,The Third Xiangya Hospital,Central South University,Changsha 410013,Hunan,China

g Clinical Medical College of Hunan University of Chinese Medicine,Changsha 410007,Hunan,China

Keywords:Hypertrophic scar Rabbit ear hypertrophic scar model Autophagy Beclin-1 LC3 p62

ABSTRACT Background:The role of autophagy in the formation of hypertrophic scars(HS)remains unclear.This study aimed to explore the role and potential mechanism of autophagy during the development of HS.Methods: RNA and protein expression levels of Beclin-1,p62,and LC3II in normal skin tissues and HS specimens from different patients were examined.Autophagy inducers and inhibitors were used to cure established HS in rabbit ears,and the expression of Beclin-1,p62,and LC3II at the RNA and protein level was determined.Lastly,the effects of autophagy inducers and inhibitors on HS development were analyzed.Results:Compared to normal skin tissues,the expression of LC3II and Beclin-1 was higher(P＜0.05),while that of p62 was lower (P＜0.05) in HS tissues.In addition,the LC3II/LC3I ratio was increased during HS formation,and the altered expression of the three proteins stabilized after one year.Administration of autophagy inducers enhanced the formation of HS as well as the expression levels of LC3II and Beclin-1 but decreased p62 expression.Meanwhile,administration of autophagy inhibitors increased the expression of LC3II,Beclin-1,and p62,along with reduced HS formation.Conclusion: Autophagic activity increased during HS initiation and subsequent stabilization.In addition,autophagy inhibitors were able to inhibit HS formation by suppressing autophagy,whereas autophagy inducers promoted scar hyperplasia by enhancing autophagy.

1.Introduction

Hypertrophic scars (HS) result from major skin wounds following surgery,trauma,or burns.1HS is characterized by excessive deposition of fibroblast-derived extracellular matrix proteins,especially collagen,and prolonged inflammation and fibrosis.2Autophagy is a catabolic‘self-eating’process that plays diverse roles in the development of various diseases.For instance,deregulation of autophagy is associated with the occurrence and development of diseases,such as neurodegenerative and autoimmune diseases,pathogenic microbial infections,and malignant tumors.3-6However,it is not known whether this prevents HS formation.

The LC3,Beclin-1,and p62 genes are the major players in autophagy.Beclin-1 was the first gene found to activate autophagy in mammals and has been used to develop autophagy interventions.7,8LC3,which has types I and II,is a reliable biological marker that reflects autophagic activity.9During autophagy,LC3I is covalently linked with phosphatidylethanolamine,inserted into the double-layer membrane of the autophagosome,and converted to LC3II.10More importantly,the conversion of LC3I to LC3II reflects the state of autophagy,and the ratio of LC3II to LC3I is commonly used for measuring the autophagic process.11During autophagy,p62 binds to intracellular ubiquitinated proteins,forming a complex with LC3II proteins located on the autophagosome membrane and is subsequently degraded by autophagic lysosomes.12In particular,the degradation of p62 promotes autophagic activity.13Collectively,these three indicators can be used to gauge autophagic activity at three different stages.14

Many studies have confirmed the importance of inflammatory factors,extracellular matrix,and proteases in fibroblast proliferation.15-17However,the mechanisms of HS formation and development remain elusive.18Shi et al.19showed that autophagy was abnormally expressed in scar tissue;hence,it may be associated with scar cancer.Meanwhile,Cao et al.20found that a combination of apoptotic drugs and autophagy inhibitors suppressed collagen synthesis in HS fibroblasts.

As previous studies have not revealed a clear role for autophagy in HS formation,we aimed to investigate the expression of autophagy-related proteins in human HS at different stages.Furthermore,we evaluated the relationship between autophagy and scar hyperplasiain vivo.

2.Materials and methods

2.1.Animals

A total of 31 young female and male New Zealand white rabbits(1.5-2.0 kg)were used in this study.The rabbits were provided with food and waterad libitum.All animal experiments were approved by the Institutional Animal Care and Use Committee of the Xiangya Medical College of Central South University.

2.2.Clinical specimens

In total,40 fresh tissue specimens,including 15 HS samples,15 normal tissues adjacent to scar sites,and 10 HS tissues obtained at different time periods (1,2,6,12,and 24 months) were investigated.Specimens were collected from patients at the Third Xiangya Hospital of Central South University between 2016 and 2018.The pathological characteristics of the patients were identified by pathologists.Sample collection was approved by the Biomedical Research Ethics Committee of the Third Xiangya Hospital of Central South University.Written informed consent was obtained from all patients.

2.3.Immunohistochemical assay for Beclin-1,p62,and LC3II

Fifteen HS tissues and 15 normal tissues adjacent to the scars were fixed in 10%neutral formalin,embedded in paraffin,and deparaffinized.The sections were stained with Beclin-1,p62,and LC3II using standard immunohistochemical techniques.The stained sections were assessed by two independent pathologists who were blinded to the clinical outcomes.The results were analyzed using a previously described method.21Protein expression was determined based on the ratio of positive cells and staining depth (scores of 0-3 were considered negative,whereas scores＞3 were considered positive).

2.4.Western blotting of Beclin-1,p62,and LC3

Of the 15 HS tissues and 15 normal tissues adjacent to the scar,eight cases(four each)were randomly selected to determine Beclin-1,p62,and LC3 protein expression at different time points.The tissues were lysed in 300 μL radioimmunoprecipitation assay buffer,and the protein concentration was measured using a bicinchoninic acid protein assay kit(Thermo Fisher Scientific,Waltham,MA,USA).Proteins were separated by electrophoresis and transferred onto polyvinylidene fluoride membranes.The membranes were incubated overnight with antibodies for Beclin1 (1:500;Proteintech,Chicago,IL,USA),LC3 (1:500;Abcam,Cambridge,UK),p62 (1:1 000;Proteintech),and beta-actin (1:500;Proteintech).Next,the membranes were incubated with horseradish peroxidase (HRP) goat anti-mouse IgG (1:5 000;Proteintech) and HRP goat anti-rabbit IgG (1:6 000;Proteintech).The blots were developed using the SuperECL Plus kit (Advansta,USA),and the images were scanned and analyzed using the Quantity One analysis software.

2.5.Real-time reverse transcription polymerase chain reaction of Beclin-1,p62,and LC3II mRNA

The sequences of target genes were obtained from the National Center for Biotechnology Information Gene Expression Omnibus database (htt p://www.ncbi.nlm.nih.gov/geo/),and primers were designed using Primer5 software and synthesized by Sangon Biotech(Shanghai)Co.,Ltd.The primers used were:Beclin-1 forward 5′ATGCACAGATACTCTTTTAGACC3′ and reverse 5′-GCTCCATCTGTAACTGTTCACT-3′;p62,forward 5′-GTTGGCAGAACCTCAAGACT-3′ and reverse 5′-CTTCGCCTTC CTCACGTTG-3′;LC3II,forward 5′-TACAGCAGATCCGCGACCAG-3′ and reverse 5′-CGCCGGATGATCTTGACCAAC-3′;and β-actin,forward 5′-TGGAATCCACTGGCGTCTTCAC-3′ and reverse 5′-AGGATGCGTTGCTGACAATCTTGA-3′.β-actin was used as a housekeeping gene.

Total RNA was extracted using TRIzol Reagent(Invitrogen,Waltham,MA,USA) according to the manufacturer’s instructions,and its concentration was measured using an ultraviolet spectrophotometer.RNA(0.5 μg)was reverse transcribed to cDNA using a reverse transcription kit(Kangwei Century Biotechnology Co.,Ltd.,Beijing,China).Real-time polymerase chain reaction was carried out using the SYBR Premix Ex Taq kit(Kangwei Century Biotechnology Co.,Ltd.).The experiment was performed three times,and the results were analyzed using the 2-ΔΔCtmethod.

2.6.Establishment of a rabbit ear hypertrophic scar model

A rabbit ear model of cutaneous HS was established as previously described.22Briefly,15 rabbits were anesthetized under sterile conditions and prepared for wounding.Using a surgical blade,wounds(1.0 cm × 1.0 cm) were created down to the cartilage on the ventral surface of each ear,at an interval of ＞2 cm.The skin layer was removed from the sites in each ear to expose the wounds to the air.Any wound with infection or necrosis was excluded from the study.

2.7.Effects of drugs on autophagy and hypertrophic scar formation

A total of 96 HS were established in 16 rabbits.Rabbit ears were divided into eight random groups,i.e.,group A (blank control group),which received normal saline;group B (standard control group),which received triamcinolone acetonide;treatment groups C,D,and E,which received low (50 μg/mL),medium (500 μg/mL),and high (5 mg/mL)chloroquine (autophagy inhibitor) doses,respectively;and groups F,G,and H,which received low(1 mmol/L),medium(10 mmol/L),and high(100 mmol/L)lithium chloride(autophagy inducer)doses,respectively.All drugs (0.2 mL) were administered via an intrascar injection twice a week.Rabbit ear HS specimens were collected at eight weeks,and scar tissues were examined by hematoxylin and eosin (HE) and immunohistochemical staining.In addition,the scar elevation index(SEI),which is the ratio of the total scar area to the area of normal underlying dermis,23was measured using ImageJ(National Institutes of Health,Bethesda,MD,USA).The expression of Beclin-1,LC3II,and p62 in all samples was analyzed by RT-qPCR and western blotting.

2.8.Statistical analysis

Data are presented as the mean±standard deviation.Statistical analysis was performed using SPSS software(version 25.0;SPSS,Inc.,Chicago,IL,USA).A chi-square test was used to compare the protein-positive rates among different pathological features.Thet-test(two-tailed,unpaired)was used to compare the two study groups.Statistical significance was set atP＜0.05.Figures were created using GraphPad Prism7(GraphPad Software,Inc.,La Jolla,CA,USA).

Fig.1.Autophagy activation enhanced in the early stage of HS formation.(A) Immunohistochemical results of LC3II,Beclin-1,and p62 in HS and normal tissues(immunohistochemistry:×400).(B) Protein expression of Beclin-1,p62,and LC3 determined by western blotting (case-:normal tissues,case+:hypertrophic scar tissues).(C)mRNA levels of Beclin-1,p62,and LC3II/LC3I.(D)Protein expression of Beclin-1,p62,and LC3 in HS tissues at different disease time points determined by western blotting.(E)Protein expression of Beclin-1,p62,and LC3II/LC3I in HS tissues at different disease time points.(F)mRNA levels of LC3II,p62,and Beclin-1 in HS tissues at different disease time points.

Fig.2.Appearances of rabbit ear scar under different drug interventions.(A) Normal saline group:HS tissues were thick with marked pigmentation.(B) Triamcinolone group:HS tissues were flatter but had more obvious pigmentation.(C-E)Low-,medium-,and high-concentration chloroquine groups:HS tissues were flatter with fewer pigmentation,and the scars of the low-concentration group were the flattest with little pigmentation.(F-H)Low-,medium-,and high-concentration lithium chloride groups:HS tissues were thicker with more pigmentation,which increased with lithium chloride concentration.

Fig.3.HE staining of HS of rabbit ears at eight weeks in each group.(A) Normal saline group:Cuticle was thick,and fibroblasts proliferated with irregular arrangement.Inflammatory cell infiltration and microvascular hyperplasia were apparent.(B)Triamcinolone group:Cuticle was thinner with fewer fibroblasts.The collagenous fibers were arranged neatly.(C-E)Low-,medium-,and high-concentration chloroquine groups:Number of fibroblasts decreased,with that of the low-concentration group being the smallest.(F-H) Low-,medium-,and highconcentration lithium chloride groups:Number of fibroblasts increased,and the cuticle was thicker,and that of the high-concentration group was the thickest.Scale bars,50 μm.

3.Results

3.1.Clinical findings

The expression of LC3II,p62,and Beclin-1 in HS and normal skin tissues was examined via immunohistochemistry (Fig.1A),which showed that the expression of LC3II and Beclin-1 in HS tissues was higher than that in normal skin tissues.In contrast,the expression of p62 in HS tissues was lower than that in normal skin tissues,as shown in Fig.1B.In addition,Beclin-1 expression and LC3II/LC3I ratio were significantly higher (P＜0.05) in human HS tissues than in normal skin tissues(Fig.1C).Conversely,the expression level of p62 in human HS tissues was significantly lower than that in normal tissues(P＜0.01).

Expression of p62 in HS tissues decreased,whereas that of Beclin-1 and LC3II/LC3I increased as the disease progressed.One year after the operation,the levels of Beclin-1,p62,and LC3II/LC3I were stabilized.The levels of LC3II,p62,and Beclin-1 mRNA in HS tissues of patients at different time points are shown in Fig.1F.The relative expression levels of p62 mRNA decreased along with disease progression,after which it stabilized,while Beclin-1 mRNA expression increased then stabilized over the course of the disease.Collectively,these results suggest that autophagy is enhanced in the early stages of HS formation and becomes stabilized afterwards.

Fig.4.SEI of rabbit HS ear tissues at week 8.The SEI of the chloroquine group was lower than that of the normal saline group,while that of the lithium chloride group was higher.****P＜0.01.

3.2.Animal test results

3.2.1.Autophagy regulators affect the degree of scar hyperplasia

The scar appearance after administration of different drugs is shown in Fig.2.Thick HS and obvious pigmentation were observed in the normal saline group (Fig.2A),while the HS in the triamcinolone treatment group was thinner but had more pronounced pigmentation(Fig.2B).Compared to the normal saline group,the scars in the chloroquine groups were more leveled and had fewer pigmentations(Fig.2C-E),with those in the low-concentration chloroquine group being the flattest and having little pigmentation.Conversely,compared to those in the normal saline group,the scars in the lithium chloride groups were thicker and had higher pigmentation(Fig.2D-F),which increased with the concentration of lithium chloride.

The results of HE staining for all groups at week 8 are shown in Fig.3.In the normal saline group,scar cuticles were thick and proliferated with irregular arrangement,with high inflammatory cell infiltration accompanied by microvascular hyperplasia.In contrast,the cuticles of scars treated with triamcinolone acetonide were thinner and had fewer fibroblasts,and the collagenous fibers were neatly arranged.After chloroquine treatment,the number of fibroblasts decreased,with scars in the low-concentration group showing the least number.Meanwhile,lithium chloride treatment increased the number of fibroblasts and thickened the cuticles,and the high-concentration group exhibited the thickest cuticles.

The SEI results for all the samples are shown in Fig.4.The SEI of the chloroquine group was lower than that of the normal saline group,while that of the lithium chloride group was the highest.Inthe chloroquine group,low-,medium-,and high-concentration treatments showed an SEI of 1.33 ± 0.04,2.01 ± 0.07,and 2.13 ± 0.06,respectively.In the lithium chloride group,the SEI of the low-,medium-,and high-concentration treatments were 3.02±0.16,3.86±0.11,and 4.94±0.14,respectively.The SEI of the normal saline group was 2.37 ± 0.07 (Supplementary Table 1).

3.2.2.Autophagy regulators affect autophagy activity

Immunohistochemical results showing protein levels in HS of the different the groups at week 8 are shown in Fig.5.There was no significant difference in the expression levels of Beclin-1,p62,and LC3 between the normal saline and triamcinolone groups.However,their expression in the chloroquine group was higher than in the normal saline group.In the lithium chloride group,the expression level of Beclin-1 and LC3 increased,whereas that of p62 decreased.

Fig.6A shows the mRNA levels of genes in HS in the different groups at eight weeks.In the chloroquine group,LC3II,Beclin-1,and p62 mRNA levels decreased with increasing concentrations of chloroquine(Supplementary Table 2).In the lithium chloride treatment groups,the relative mRNA expression levels of LC3II and Beclin-1 were increased,while those of p62 were significantly reduced.Chloroquine treatment increased the protein levels of Beclin-1,LC,and p62 (Fig.6B).In contrast,lithium chloride treatment increased the levels of Beclin-1 and LC3II/LC3I,but decreased the levels of p62.

4.Discussion

Autophagy is a basic and highly conserved biological process that maintains physiological homeostasis and prevents pathogen invasion in all organisms,and its dysregulation is involved in the development of multiple diseases.In this study,we used LC3,Beclin-1,and p62 to gauge autophagy activity at three different stages.

The results showed that expression of Beclin-1,LCII3,and LC3II/LC3I was higher in human hyperplastic scar tissues than in normal human tissues.However,compared to normal human tissues,the expression of p62 was lower in human hyperplastic scar tissues.These findings suggest a positive correlation between autophagy and HS formation.Clinically,scar formation occurs in four overlapping stages based on the timing and tissue changes,namely the inflammation(0-21 d),proliferation(21 d-6 months),and remodeling or maturation phase (6-24 months).In the present study,we found that autophagy activity was enhanced in the early stage of HS formation,after which it stabilized over time.

Based on the aforementioned findings,we selected chloroquine and lithium chloride for HS treatment.First,we used triamcinolone as the standard control,which is commonly used to treat HS in clinical settings with satisfactory effects.Second,we used chloroquine as an autophagy inhibitor,which does so by preventing lysosomal dissolution.Certain successes with autophagy-related treatments in clinical trials have been observed,and drugs such as chloroquine and hydroxychloroquine have been approved by the US Food and Drug Administration for the treatment of corresponding diseases,including malaria and cancer.Chemotherapy in combination with chloroquine and hydroxychloroquine improves survival outcomes in patients with myeloma,melanoma,and pancreatic adenocarcinoma.24-26Third,we used lithium chloride to enhance the autophagic activity.Lithium chloride is an autophagy inducer that functions by inhibiting inositol monophosphatase.Studies have shown that lithium chloride can play a role in repairing the spinal cord by promoting autophagy in spinal cord injury.27

Fig.5.Immunohistochemical staining for Beclin-1,p62,and LC3II expression in HS of rabbit ears at week 8.(A) Normal saline group.(B) Triamcinolone group.(C-E)Low-,medium-,and high-concentration chloroquine groups.(F-H) Low-,medium-,and highconcentration lithium chloride groups.There was no significant difference in the expression of Beclin-1,P62,and LC3II between groups A and B.The expression of Beclin-1,LC3II,and P62 in groups C,D,and E were stronger than that in group A.In groups F,G,and H,the expression of Beclin-1 and LC3II increased,whereas that of P62 decreased.

Fig.6.Relative expression levels of LC3II,p62,and Beclin-1 in each group at week 8.(A)The relative expression of Beclin-1,p62,and LCII mRNA in each group at week 8.(B) Beclin-1,p62,and LC3II protein bands in each group at week 8 were detected by western blotting.Compared to those in the normal saline group,the relative expression levels of LC3II,Beclin-1 and p62 increased after administration of chloroquine.In the lithium chloride groups,the relative expression levels of LC3II and Beclin-1 increased,whereas those of p62 significantly decreased.

A rabbit ear HS model was established to monitor the expression of Beclin-1,LC3II,and p62 in relation to changes in autophagic activity under different drug treatments.In this study,chloroquine was found to inhibit autophagy by preventing lysosomal dissolution,leading to a high expression of Beclin-1,LC3II,and p62.Conversely,lithium chloride enhanced autophagic activity,resulting in an increase in Beclin-1 expression and LC3II/LCI ratio and a decline in p62 expression.Moreover,administration of an autophagy inhibitor increased the protein expression of Beclin-1,LC3II,and p62,but this effect was reversed by an autophagy inducer.Autophagy inhibitors suppressed HS hyperplasia,and opposite results were observed in autophagy inducer groups.These results suggest that autophagy may be a new target for the prevention of HS formation.In our results,the relationship between drug concentration and action was not proportional.This is because factors such as metabolic pathways and otherin vivoparameters may affect the action of autophagy inducers and inhibitors.Further research is required to determine the safest and optimal concentrations of autophagy inhibitors.

This study,however,has some limitations.First,due to the difficulty in obtaining human HS specimens of less than two years,we used a limited sample size,and the span of the disease course was large.In addition,the specimens were obtained from different patients at different time points along the disease course,making the results incomparable.Second,although the three indicators in our study stabilized after one year,the time coinciding with the turning point of expression was not given.To determine this,further studies with a more detailed setting of disease courses and a large sample size are required.In addition,given the individual differences in animal scar models,the present results should be confirmed throughin vitrocell experiments.Finally,our study only presents correlative and descriptive data,but the mechanism of how LC3,p62,and Beclin-1 are differentially regulated in HS and normal skin tissues remain to be explored.More studies are warranted to determine the specific types that are affected by autophagy during HS.

5.Conclusion

Autophagy activity increases during the formation of HS tissues,after which it stabilizes.In addition,autophagy inhibitors can inhibit the formation of HS,whereas autophagy inducers can produce the opposite effect.

Supplementary data

Supplementary Table 1Comparison of SEI between each group and the normal saline group.

Supplementary Table 2Comparison of the relative expression of LC3II,p62,and Beclin-1 between each group and the normal saline group.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University (approval no.2018-S239).All participants provided written informed consent prior to enrollment in the study.

Consent for publication

All patients included in this study provided written informed consent to publish the data contained within this study.

Competing interest

The authors declare no competing interests.

Authors’ contributions

Qu S and Zhou J:Conceptualization,Methodology,Software.Liu Y:Data curation,Writing-Original draft.Chen X:Visualization,Investigation.Fang Y:Supervision.Yan Y:Animal experiments.He B:Software.Liao J:Validation.Cao K:Writing-Reviewing and Editing.

Acknowledgements

This work was supported by the National Natural Science Foundation of China(grant no.81872219),Science and Technology Project of Hunan Provincial Health Commission (grant no.B2015-040),Major Scientific and Technological Projects in Hunan Province(grant no.2019SK1010),2020 Li Ka Shing Foundation Cross-Disciplinary Research Grant (grant nos.2020LKSFG18B;2020LKSFG02E),Guangdong University Innovation Team Project(grant no.2021KCXTD047).