Ganoderma lucidum spore oil(GLSO),a novel antioxidant,extends the average life span in Drosophila melanogaster

Yi Zhang,Hongfei Cai,Zhu Tao,Cheng Yuan,Zhaojian Jiang,Juyan Liub,,d,,Hiroshi Kurihara ,Wendong Xub,,aInstitute of Integrated Chinese and Western Mediine Postdotoral Researh Station,Jinan University,Guangzhou 510632,China

bPostdoctoral Research Station of Guangzhou Pharmaceutical Holdings Limited,Guangdong 510130,China

cInstitute of National Engineering Research Center for Modernization of Extraction and Separation Process of Traditional Chinese Medicine,Hanfang Pharmaceutical Co.,Ltd,Guangdong 510240,China

dGuangzhou Pharmaceutical Holdings Ltd,Guangdong 510130,China

eInstitute of Traditional Chinese Medicine and Natural Products,Jinan University,601,Huangpu Avenue West,Guangzhou,510632,China

Keywords:

Ganoderma lucidum spore oil

Antioxidant activity

Drosophila melanogaster

Anti-aging

ABSTRACT

In ancient China,Ganoderma lucidum was believed to be a medical fungus that could increase lifespan.Recently,pharmacologic studies have found that polysaccharide peptides and triterpenoids extracted from Ganoderma lucidum have various physiological effects as active compounds.However,the effects of spore oil isolated from Ganoderma lucidum remains unknown.In this study,the biological effects of Ganoderma lucidum spore oil(GLSO)were evaluated using a Drosophila melanogaster model.Compared with untreated groups,groups treated with GLSO had significantly longer average and maximum lifespan in both normal conditions and under oxidative stress.The activities of various antioxidant enzymes were measured to determine the antioxidant effect of GLSO.GLSO treatment markedly enhanced total superoxide dismutase(SOD)and catalase(CAT)activity and decreased levels of malondialdehyde(MDA).Further,we found dose-dependent increases in the mRNA expression of Cu,Zn-SOD,Mn-SOD,and CAT in GLSO-treated groups.These results suggest that GLSO may effectively eliminate free radicals and extend lifespan in Drosophila.Future work should investigate the value of GLSO as a functional food for the prevention of aging in larger animal models.

1.Introduction

Ganoderma lucidum(popularly Lingzhi)is a species of basidiomycetes which belongs to Polyporaceae of Aphyllophorales,and it has been widely used in China for hundreds of years.In ancient China,Lingzhi was believed to be a magical medical fungus that could bring longevity through mysterious powers of healing the body and calming the mind[1].Of interest,modern pharmacological and clinical investigations have demonstrated thatG.lucidumhas a number of pharmacological properties,such as antioxidation and delaying senescence[2],anti-diabetic effects[3,4],prolonging sleep time[5],neuroprotective effects[6],protection againstalcohol-induced liver injury[7,8],and a possible role in the treatment of cancer[9,10].

G.lucidumcontains abundance of natural bioactive components,mainly polysaccharides,terpenoids,glycopeptides,nucleotides,steroids,and unsaturated fatty acids.About 240 secondary compounds have been isolated fromG.Lucidum,including C30ganoderic acids,C30lanostanes,C27lucidenic acids,C27lanostanes,C24lanostanes,meroterpenoid,steroids,and benzofuran[11].Among these,the two most widely studied active components ofG.lucidumareG.lucidumpolysaccharides andG.lucidumtriterpenoids[12–14].However,research investigating the mechanisms of action and potential applications of unsaturated fatty acids isolated fromG.lucidumremains sparse to date.

The hard sporoderm ofG.lucidumspores prevents the release of its inner bioactive components[15].G.lucidumspore oil(GLSO),which is extracted fromG.lucidumspores using supercritical liquid CO2,contains a large amount of unsaturated fatty acids.It has been reported that GLSO mainly includes five constituents:palmitic acid(15.69%),hexadecenoic acid(1.73%),stearic acid(4.05%),oleic acid(65.63%),and linoleic acid(12.90%)[16].Other research has indicated a breakdown of 19.74% saturated fatty acids and 80.26% unsaturated fatty acids in GLSO.In recent years,there has been an increasing amount of studies exploring the antioxidant activity of polysaccharides isolated fromG.lucidum[17–21].However,unsaturated fatty acids,a potent antioxidant inG.lucidum,remains relatively understudied and there are few detailed reports of the bioactivity of unsaturated fatty acids inG.lucidum.

In the present study,we evaluated the biological effects of GLSO in aDrosophila melanogastermodel.The anti-oxidant activity of GLSO was measured and its potential role in preventing aging was investigated.

2.Materials and methods

2.1.Analysis of the components in GLSO

GLSO was manufactured by Hanfang Pharmaceutical Company,Guangzhou,China(batch 190101,approval number G20100150).Six standards of triglycerides found in GLSO were provided by Guangzhou University of Chinese Medicine.

The components in GLSO were distinguished by highperformance liquid chromatography with an evaporative light scattering detector(ELSD)and mass spectrometry.The chromatographic column was a Kromosil 100-5(4.6mm×250mm,5μm)and the temperature was set to 30?C.The mobile phase,which consisted of solvent A(isopropanol)and solvent B(acetonitrile),was flowed at 1.0mL/min with 53%B(V/V).Mass spectra were acquired using electrospray ionization in the positive ionization mode.

2.2.Fly husbandry and food

Flies carrying thew1118mutation(acquired from Bloomington Drosophila Stock Center,USA)were used in all experiments.Flies were maintained at 26?C on a 12:12 light/dark cycle with culture medium prepared as follows:One liter of stock medium contained 100g of dry yeast,50g of sugar,and 15g of agar.We added 0.5% propionic acid as a preservative to the culture medium to prevent rapid contamination with fungi and bacteria.

The control and drug-treated flies were fed on normal culture medium or GLSO-supplemented medium,respectively.GLSO-supplemented medium was prepared by dissolving 125(high dosage group),62.5(medium dosage group),or 31.25mg(low dosage group)of GLSO in 100mL of normal culture medium.

2.3.Life span studies in Drosophila melanogaster

Thirty synchronized flies were placed in each vial,and each dosage group contained 10–15 vials(totaln=300–450 flies per group).The number of survivingDrosophilaflies was counted every 2 days,and the culture medium was changed every 4 days until all flies died.The average life expectancy of allDrosophilaand the time until death of 90% ofDrosophilain a given treatment group were considered to be the mean life span and maximum life span,respectively.

2.4.Life span studies in the condition of oxidative stress or in oxidative stress injury

Flies were collected after being fed with GLSO for 25 days and then starved for 2 h.Flies were then placed in an empty culture vial with a filter paper soaked with 50μL solution of 6% glucose and 30% hydrogen peroxide.The vial and filter paper were replaced every 6 h.The number of surviving flies was counted every 2 h until all flies died.

2.5.Activities of antioxidant enzymes

Each group contained at least 180 newly enclosed flies(30 per vial)that were cultured for 45 days. Flies were anaesthetized using a CO2Drosophilaworkstation(Genesee Scientific Inc.,USA)after starvation for 2h.Flies were homogenized in normal saline(m/V=1:19)and then centrifuged at 10000r/min for 15min at 4?C.The supernatants were collected for subsequent enzyme assays.

The enzyme activities of Cu,Zn superoxide dismutase(Cu,Zn-SOD),total superoxide dismutase(SOD),and hepatic content of malondialdehyde(MDA)were determined using Cu,Zn-SOD Superoxide Dismutase Assay Kit,Total Superoxide Dismutase Assay Kit,and Lipid Peroxidation MDA Assay Kit(Jiancheng Bioengineering Institute,Nanjing,China),respectively,in line with the manufacturer’s instructions.

2.6.RT-qPCR

Total RNA was extracted by Trizol and 2μg of each sample was reverse transcribed with a reverse transcriptase(Takara).A realtime assay was performed using a Fast Start Universal SYBR Green Master Mix(Roche)and an Applied Biosystems 7500 PCR system.βtubulinwas used as a reference gene,and the sequences of primers for different genes were as follows:Cu,Zn-SOD:sense GCGGCGTTATTGGCATTG,anti-sense ACTAACAGACCACAGGCTATG;Mn-SOD:sense CACATCAACCACACCATCTTC,anti-sense CGTCTTCCACTGCGACTC;CAT:sense TGAACTTCCTGGATGAGATGTC,anti-sense TCTTGGCGGCACAATACTG;β-tubulin:sense AGACCTACTGCATCGACAAC,anti-sense GACCCAGTGGTTCAGGTCAC.Representative results show the averages from triplicate sample sets,with error bars representing SD.

2.7.Statistical analysis

Data were expressed as mean values with error bars representing SD/SEM.All statistics were calculated using Graphpad 6.0 software(GraphPad Software,Inc.San Diego,CA).The significance of the difference between means was assessed using Gehan-Breslow-Wilcoxon or one-way ANOVA test.P＜0.05 were considered statistically significant.

3.Results

3.1.Triglycerides were confirmed to be the main compounds in GLSO

HPLC-ELSD analysis indicated that triglycerides were the main compounds in GLSO(Fig.1).Six main peaks of triglycerides were found to be in good agreement with standards on the basis of shared retention times and mass irons.The total content of triglycerides in GLSO was 75.33%.

3.2.GLSO extended the life span of Drosophila melanogaster

To test the effects of GLSO supplementation on life span,adult flies were raised on culture medium supplied with a low,medium,high,or no dose of GLSO.As shown in Fig.2,GLSO supplementation significantly increased the average life span in both male and femaleDrosophila.Detailed data are shown in Fig.2C.Of note,treatment with both 0.625 and 1.25mg/mL GLSO increased the average life span in male and female flies.

Fig.1.Chromatograms of GLSO(3mg/mL).Six main peaks of triglycerides were measured and the total content of triglycerides was 75.33% in GLSO.

Fig.2.GLSO supplementation extended the average life span both male(A)and female(B). Effects on mean life and maximum life span of Drosophis supplement with different dosage GLSO(C).The significance of the difference between survival curves(n=300 flies per group)was analyzed using the Gehan-Breslow-Wilcoxon test.*P＜ 0.05,**P＜0.01,***P＜0.001 versus the control group.

Fig.3.GLSO supplementation extended the average life span both male(A)and female(B)in the condition of oxidative stress caused by hydrogen peroxide.Effects on mean life span and maximum life span of Drosophis supplement with different dosage GLSO in oxidative stress injury(C).The significance of the difference between survival curves(n=300 flies per group)was analyzed using the Gehan-Breslow-Wilcoxon test.*P＜0.05,**P＜0.01,versus the control group.

Table 1Effects on SOD and CAT activities and the level of MDA supplement with different dosage GLSO.

The mean life span and maximum life span of the 1.25mg/mL group were significantly increased by 11.85% and 6.45% respectively in females,10.13% and 5.31% in males,relative to the control group(P＜0.001).From these observations,we speculate that GLSO supplementation may be beneficial to health and extend the average and maximum life of flies.

3.3.GLSO extended the average survival time of Drosophila melanogaster after oxidative stress

GLSO supplementation significantly increased the average survival time in both male and female flies subjected to oxidative stress by treatment with hydrogen peroxide(Fig.3).After treatment with 1.25mg/mL GLSO,the mean and maximum life span were increased by 9.97%(P＜0.05)and 11.18%(P＜0.05)respectively in female flies,12.58%(P＜ 0.05)and 14.55%(P＜ 0.01)in male flies.We next sought to determine the extent to which GLSO enhanced antioxidant activity.

3.4.GLSO enhanced antioxidant activities

It has previously been shown that the levels of MDA and activities of antioxidant enzymes SOD and CAT are directly related to the life span of Drosophila[22].Here,we found that GLSO treatment significantly enhanced SOD and CAT activity,however the level of MDA was notably decreased(Table1).The enzyme activities of flies treated with 1.25mg/mL GLFO were significantly increased relative to the control group:Cu,Zn-SOD by 15.2%(P＜0.05),Mn-SOD by 31.04%(P＜0.05),CAT by 36.11%(P＜0.01)in females;Cu,Zn-SOD by 22.7%(P＜0.05),Mn-SOD by 34.5%(P＜0.05),CAT by 35.4%(P＜0.05)in males.Conversely,the production of MDA was decreased 37.5%(P＜0.05)in females and 37.7%(P＜0.01)in males compared to the control group.

Fig.4.GLSO supplementation increased the mRNA expression of Cu,Zn-SOD,Mn-SOD and CAT in Drosophis both male and female.The significance of the difference between survival curves(n=300 flies per group)was analyzed using the one-way ANOVA test.*P＜0.05,**P＜0.01,***P＜0.001 versus the control group.

3.5.GLSO increased the mRNA expression of Cu,Zn-SOD,Mn-SOD and CAT enzymes

The effect of GLSO on the expression ofCu,Zn-SOD,Mn-SODandCATmRNA was evaluated by RT-PCR.Dose-dependent increases in the expression ofCu,Zn-SOD,Mn-SOD,andCATmRNA(Fig.4)were observed in the GLSO-treated groups.This GLSO-mediated increase in mRNA expression was most clearly seen in flies treated with 1.25mg/mL GLSO.The mRNA expression of flies treated with 1.25mg/mL GLFO were significantly increased relative to the control group:Cu,Zn-SODby 68%(P＜ 0.01),Mn-SODby 50%(P＜0.01),CATby 83%(P＜0.001)in females;Cu,Zn-SODby 64%(P＜0.01),Mn-SODby 66%(P＜0.001),CATby 79%(P＜0.001)in males.

4.Discussion

Ganoderma lucidumhas long been believed to have beneficial health effects,but has only recently been objectively evaluated for potential activities.In this work,GLSO led to significant improvements in lifespan and anti-oxidation in aDrosophila melanogastermodel.This research suggests GLSO may have potential as an antiaging functional food.

This study explored the effect of GLSO on the life span ofDrosophila melanogaster.Drosophila models are commonly used to elucidate mechanisms of aging[23,24].Our data indicated that,compared with untreated groups,GLSO-treated flies had signi ficantly longer average and maximum life(Fig.2).Upon measuring this effect,we further sought to begin to explore the mechanisms of the benefits provided by GLSO.

It is important to note that there is a significant difference between the extracts used in the present study and other studies.In most studies,G.lucidumwas extracted by water or ethanol[25,26].Thus,these extracts contained polysaccharide peptides or triterpenoids and other active constituents with similar polarity to the solvents,but only retained a limited fraction of liposoluble compounds.Here,GLSO was extracted fromG.lucidumsporesusing supercritical liquid CO2in order to isolate unsaturated fatty acids.The content of unsaturated fatty acids may show a little difference compared with some research due to different extracted condition.There were 75.33% unsaturated fatty acids in GLSO,which may be expected to have some antioxidant activities.The unsaturated fatty acids of GLSO were primarily oleic acid and linoleic acid.Oleic acid has been reported to contribute to longevity by promoting membrane fluidity,minimizing oxidative stress,enhancing energy storage,or activating signalling pathways,and it has been suggested that dietary supplementation with oleic acid may increase lifespan[27,28].

However,we can only find sporadic reports indicating that GLSO may have an effect on lifespan[29].In order to explore the biological effects of GLSO,its antioxidant activity was evaluated by studying changes in mean and maximum life span ofDrosophilaafter treatment with hydrogen peroxide[30].We found that GLSO extended the average survival time ofDrosophilain conditions of oxidative stress injury(Fig.3),suggesting that GLSO might have radical scavenging activity.

Fig.5.The mechanisms of GLSO for prolonging life.GLSO treatment can significantly enhance the activity of antioxidant enzymes(SOD,CAT).In correlation,GLSO treatment can increase the mRNA expression of these enzymes.

The radical scavenging activity of GLSO seems to be related to an increase in the activity of several antioxidant enzymes:superoxide dismutase(SOD),which catalyzes dismutation of superoxide anion to hydrogen peroxide,and;catalase(CAT),which detoxifies hydrogen peroxide and converts lipid hydroperoxides to nontoxic substances.The activities of antioxidant enzymes were measured to determine the indirect antioxidant properties of GLSO.GLSO treatment significantly enhanced SOD and CAT activity(Table 1)and decreased the level of MDA,which is a product of lipid peroxidation induced by free radicalsin vivo.Furthermore,the mRNA expression of Cu,Zn-SOD,Mn-SOD,and CAT enzymes was quantified.GLSO markedly increased the mRNA expression of these enzymes in a dose-dependent manner(Fig.4).

The long-term existence of free radicals and reactive oxygen species can lead to accelerated aging and many age-related diseases.Indeed,all flies died within 48h after treatment with 30% hydrogen peroxide(Fig.3).GLSO supplementation extended the average life span of both male and female flies under oxidative stress,suggesting strong anti-oxidant effects.The mechanisms by which GLSO may contribute to prolonging life are a subject of continuing research.GLSO appears to have two main types of roles(Fig.5).

Much of the superoxide produced on the matrix side of the mitochondrial inner membrane is converted by Mn-SOD[31].Antioxidant enzymes,such as SOD,and CAT,are crucial for limiting the level of free radical molecules in order to slow down the aging of living organisms[32].MDA,the by-product of lipid peroxidation,increases with age and causes the structural and functional alterations associated with aging organs[33].GLSO treatment significantly enhanced the activity of antioxidant enzymes(SOD,CAT)and decreased the level of MDA.Indeed,GLSO treatment increased the mRNA expression of these enzymes.We believe that this may be an important mechanism contributing to the GLSO-mediated extension of average and maximum lifespan inDrosophila.Further studies should evaluate the toxicity and potential for anti-aging and lifespan-increasing properties of GLSO in larger animal models.

5.Conclusion

In this work,we found that GLSO was an effective anti-aging treatment inDrosophila.GLSO treatment significantly extended average and maximum lifespan inDrosophilaboth in normal conditions and in oxidative stress due to its excellent antioxidant capacity.Further,GLSO treatment enhanced SOD and CAT activity and decreased the level of MDA.The expression ofCu/Zn-SOD,Mn-SOD,andCATenzyme mRNA were increased in GLSO-treated flies.G.lucidum,a medical fungus that has been used for more than 2000 years,has long been thought to have a positive impact on human health.In addition to previously isolated active compounds such as polysaccharide peptide or triterpenoids,spore oil fromG.lucidumhas the potential to be a functional food for preventing aging-related diseases.

Declaration of Competing Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

This work was supported by the Science and Technology Department of Guangdong Province(No.2016B030302003)and the Ministry of Science and Technology of China(No.2017YFC1703104).