Shiqi herbal tea reduces the susceptibility to H1N1 influenza virus in stressed mice.

Guo Xie,Zhuo Luo,Lu-Ping Tang,Li-Hang Zhang,Li-Hua Peng,Ling Jin,Hiroshi Kurihara,Jin-Le Cheng＊,Yi-Fang Li＊,Rong-Rong He

1 Zhongshan Institute,University of Electronic Science and Technology of China,Zhongshan 528402,Guangdong,China.

2 International Cooperative Laboratory of Traditional Chinese Medicine Modernization and Innovative Drug Development of Chinese Ministry of Education (MOE),College of Pharmacy,Jinan University,Guangdong,China.

3 Key Laboratory of Technology and Application of Ultrafine Granulated Powder of Traditional Chinese Medicine,State Administration of Traditional Chinese Medicine of the People's Republic of China,Zhongshan 528437,Guangdong,China.

4 Guangdong Province Research and Development Center for Chinese Medicine in Disease Susceptibility,College of Pharmacy,Jinan University,Guangdong,China.

5 Department of Traditional Chinese Medicine,The First Affiliated Hospital,Jinan University,Guangdong,China.

Abstract Objective: It is well known that stress plays a critical role in immune response and susceptibility to diseases.Among many stressors,restraint stress has been shown to suppress immune function and increase susceptibility to infections.In this study,we employed a restraint-mouse model to investigate the effect and preliminary mechanism of ShiQi herbal tea (SQHT),a traditional Chinese medicine,on H1N1 virus infection.Methods: Mice were exposed to restraint stress and infected with H1N1 influenza virus by intranasal inoculation.SQHT (936 and 1872 mg/kg/d) was orally administrated to mice for 7 days from the first day of restraint stress.The survival rate of mice in each group was monitored daily for 21 days.Histopathological changes,inflammatory cells infiltration,and virus titer in lungs were examined.For the study of mechanisms,we investigated whether SQHT could promote interferon-β (IFN-β) generation and interferon stimulated genes(ISG) expression.Results: Our results suggested that SQHT (936 mg/kg/d) significantly reduced H1N1-induced mortality,the level of complement C5a and lung tissue inflammation,and viral replication in restraint-stressed mice.Further results revealed that in restraint-stressed mice model,SQHT (936 mg/kg/d) administration markedly improved IFN-β generation,and increased MX1 and IFITM3 gene expression.Conclusion: Our study demonstrates that SQHT reduces restraint stress-induced susceptibility to H1N1 infection via improving IFN-β antiviral pathway,which provides a certain basis for the clinical use of SQHT to treat H1N1 infection.

Keywords: ShiQi herbal tea,Restraint stress,H1N1 virus,C5a,Interferon-β,Susceptibility

Background

Influenza virus is one of the most common causes of respiratory infections in humans with high morbidity and mortality.Typically,the latest influenza epidemics analysis indicates that an average of 389,000 respiratory deaths are associated with influenza infection globally each year [1].Moreover,the influenza pandemic occurred frequently due to the emergence of a new strain,the antigenic drift and shift of virus mutations,which can result in rapid transmission and high attack rates and even high mortality worldwide [2].Although many chemical antiviral drugs have been used clinically and effectively,the emergence of influenza virus drug resistant and subsequent side effect are still the leading causes of infection severity and mortality in influenza patients.Therefore,more and more attentions have been paid to explore the anti-influenza effects of natural substances.In China,some traditional Chinese medicines (TCMs)or natural plants has been used to prevent or treat influenza infection in clinical or scientific practice for a long time [3,4].

ShiQi herbal tea (SQHT),a classical TCM,is the extract from five south Chinese herbals,including Gangmei (Radix Ilex Asperlla) 4.9 g,Ludoule (Radix Pandanus Tectorius) 4.9 g,Tiebaojin (Radix Berchemia Lineata) 4.9 g,Choumoli (Radix Clerodendrum Philippinum) 1.96 g and Putao (Caulis Syzygium Jambos) 4.9 g.It has been widely used as a common traditional drug for preventing influenza,treating fever and headache due to syndrome with external factors,and treating bloating due to food stagnation,dry throat and tongue over 100 years.Previous studies have indicated that it could exert various therapeutic effects,including the relief of fever and cough,anti-inflammation,diuresis,and so on[5].Influenza virus can infect lots of people,especially some high risk crowd who have weakened immunity,such as newborns,the elderly,the sick,and individuals with fatigue or stress [6].Recently,our studies have revealed that restraint stress increased risk to bacterial pathogens or virus,diminished the strength of immune defense,and aggravated the severity of infectious disease [7,8].These findings suggest that restraint stress enhances the susceptibility of infectious disease and also prolongs infectious disease episodes [7].Stress-related immune dysregulation may be the core mechanism behind a variety of infectious diseases [9,10].Hence,the development of antiviral drugs or compounds that have the potential to modulate stressmediated immunity dysfunction,may play an important role in influenza treatment.In this study,the effect and preliminary mechanisms of SQHT on anti-influenza virus were investigated in restraint-stressed mouse model.

Materials and methods

Drugs and reagents

SQHT (Batch No.SQWG20130704) was provided by ZEUS Pharmaceutical Group (Zhongshan,China).Its chemical constitutes were determined by HPLC(Agilent Technologies,USA) analysis.As shown in Figure 1,the preparative HPLC chromatographic columns were used to obtain peaks of primary components in the HPLC fingerprint.The main peaks in HPLC fingerprint were demonstrated as ellagic acid-4-O-arabinoside (1),acteoside (2),rubrofusarin-6-Orhamonsyl-glucopyranside (3),pomolic acid-3-Oglucoside-28-O-(3'-O-sulfonyl)-glucuronide (4),pomolic acid-3-O-glucoside-28-O-(3'-O-sulfonyl)-arabinoside (5),siaresinolic acid-3-O-glucoside-28-O-(3'-O-sulfonyl)-arabinoside (6),rotundic acid (7),pomolic acid-3-O-(3'-O-sulfonyl)-glucuronide (8),19-dehydro-ursolic acid-3-O-(3'-O-sulfonyl)-arabinosideglucoside (9) and pomolic acid (10).Among these peaks,pomolic acid and its glycoside derivatives are representative components ofRadix Ilex Asprella.Ribavirin injection was purchased from Guangzhou Baiyunshan Tianxin Pharmaceutical Co.,Ltd.(Guangzhou,China).

Virus

Figure 1.Chemical profile of SQHT analyzed by HPLC.The compounds were eluted (eluent A,0.1%formic acid in water; eluent B,acetonitrile) at a flow rate of 0.4 mL/min using a gradient program (0-2min,B: 5%; 2-34min,B: 5%-23%; 34-65min,B: 23%-51%;65～71min,B: 51%-95%; 71-74min,B: 95%; 74-75min,B: 95%～5%; 75～78min,B: 5%).

The influenza A/FM/1/47 (H1N1) was donated by College of Veterinary Medicine of South China Agricultural University (Guangzhou,China).The virus strain was propagated in specific pathogen-free fertilized eggs and adapted for lethality in mice after three passages in the animal.Virus containing allantoic fluid was harvested and stored in aliquots at -80℃.The LD50was determined in mice after serial dilution of the stock and 2×LD50was used for viral challenge in all the experiments.Infection was established by intranasal inoculation in mice anesthetized by ethyl ether.

Animals and treatments

Five-week-old male Kunming mice weighing between 13 and 15 g were purchased from Guangdong Medical Laboratory Animal Center (No.SCXK2013-0002,Guangzhou,China).All mice were kept in a pathogenfree animal room with temperature at 23 ± 1℃ and humidity at 60 ± 5%.An alternating 12 h light-dark cycle was maintained,with lights on from 06:00 to 18:00.The mice were provided with standard laboratory diet and waterad libitum.The animals acclimatized the environment for one week before the pharmacology experiment.All animal care and experimental procedures were approved by theAnimal Care and Use Committee of Jinan University,and were in accordance with theNational Institute of Health’s Guide for the Care and Use of Laboratory Animals(7th edition,USA).The experimental mice were randomly divided into 6 groups: “Normal” group,“Virus” group,“Stress+ Virus” group,“Ribavirin” group (restraint +virus + 50 mg/kg/d Ribavirin),and low and high dose“SQHT” groups (restraint + virus + 936 or 1872 mg/kg/d SQHT),which were described as SQHT-L and SQHT-H respectively.The doses of SQHT were converted from its clinical dose.For restraint stress protocol,mice were physically restrained in a 50 mL polypropylene tube with holes for 18 h.After recovering for 3 days,the animals were anesthetized by inhalation of diethyl ether vapor and then an approximate 2 × LD50amount of virus (35 μL) was instilled into the nares.Ribavirin and SQHT were administered to mice the day before stress by oral gavage for 7 days,while the rest of the groups received saline only.Mice were recorded daily for 21 days or until death.Survival rate and mean dead day were consequently calculated.

Lung histopathological analysis

Four days post virus infection,mice were weighed an d anesthetized by ethyl ether.The lungs were removed,washed,dried and weighed.Lung index was calculated as a parameter of inflammatory edema according to the following formula: Lung index (mg/g) = lung weight/body weight × 100%.For histopathological examinations,the lungs were immediately fixed in 4%buffered formaldehyde processed routinely.Paraffin sections,5-μm thick,were stained with hematoxylin and eosin and then examined under microscopy in a blinded fashion.Pathological score based on the criteria: 0,no pneumonia; 1,mild interstitial pneumonia (＜25% of the lung); 2,moderate interstitial pneumonia (25-50% of the lung); 3,severe interstitial pneumonia (＞50% of the lung).

Virus titers and interferon-β (IFN-β) determination in lung tissues

At 4 day post infection (dpi),lung tissues were removed and homogenized in DMEM plus antibiotics to achieve 10% (w/v) suspensions,and centrifuged at 1400 g for 20 min at 4°C to collect the supernatants.The infectivity of virus in the supernatants TCID50 assay were determined as described previously [9].IFN-β was quantitated in the supernatant of lung homogenates using ELISA Kit (R&D System).

Determination of inflammatory cell numbers and C5a concentration in bronchoalveolar lavage fluid(BALF)

BALF from mice were prepared as previously described [9].Briefly,BALF were obtained from the lungs by lavage with 1 ml PBS using a syringe,and centrifuged for 7 min at 400 x g and 4 °C.The supernatants were collected for C5a determinationby ELISA kit.The cell pellets were re-suspended in 200 μL of ACK lysing buffer and incubated for 2 min at room temperature to lyse the erythrocytes.After incubation,centrifuge and discard the supernatant and re-suspend the cells in an adequate volume of PBS for Wright-Giemsa stain.The total number of inflammatory cells were quantitated by a hemocytometer.

Viral and cellular mRNA quantification by RTqPCR

Mice lungs were harvested,frozen and homogenized in TRIzol reagent (Invitrogen) to extract RNA at 4 dpi according to manufacturer’s instructions.cDNA was synthesized from the purified RNA and oligo (dT)priming using a TransScript One-Step cDNA synthesis kit (Transgen Biotech).NP,MX1 and IFITM3 mRNA levels were measured using the SYBR green method(Applied Biosystems) on a reverse transcription (RT)machine (CFX ConnectTM; Applied Biosystems) and normalized by subtracting the threshold cycle values of 18S.Primer sequences were as follows: NP forward,5'-CAGGTACTGGGCCATAAGGAC-3',and reverse,5'-GCATTGTCTCCGAAGAAATAAG-3'; MX1 forward,5'- TCTGAGGAGAGCCAGACGAT -3',and reverse,5'-ACTCTGGTCCCCAATGACAG-3'; IFITM3 forward,5'- AAGCCTTCATCACCG-3',and reverse,5'- AGGGACCAGACCACAT-3'; 18S forward,5'-AGGGGAGAGCGGGTAAGAGA -3',and reverse,5'-GGACAGGACTAGGCGGAACA -3'.

Statistical Analysis

The data are presented as the mean ± SD.Statistical analysis of the data was performed using the GraphPad Prism 7 system.One-way analysis of variance(ANOVA) was applied to analyze differences among the different groups.Kinetics of mortality and morbidity are analyzed by Kaplan-Meier curves and log-rank test with Bonferroni adjustment.Differences were considered statistically significant at P ＜ 0.05.

Results

SQHT mitigates the mortality caused by H1N1 influenza in restraint-stressed mice

The chemical fingerprint of SQHT was determined using HPLC analysis as shown in Figure 1.Pomolic acid (peak 10) and its glycoside derivatives (peak 4,5,7),the representative components ofRadix Ilex Asperllae,were identified,indicating the rationality of the extraction method.To observe the antiviral effects of SQHT in restraint-stressed mice,the survival rate of mice was monitored daily after intranasal inoculation of H1N1 virus.As shown in Figure 2 and Table 1,a significantly lower survival rate was observed in“Stress + Virus” group as compared to “Virus” group(P ＜0.01).Only 16.6% of “Stress + Virus” group mice could survive and the mean dead day was decreased from 16.6 ± 5.7 to 11.3 ± 5.0 day when compared with“Virus” group mice (P ＜0.05).Ribavirin (50mg/kg),a positive drug,significantly improved the survival rate to 100% (P ＜0.001).SQHT also showed a protective effect on the survival of restraint mice infected with H1N1 virus,with 81.8% and 44.4% of mice surviving in the low (P ＜0.01) and high dose of SQHT treatment groups,respectively.This implies that SQHT protects restraint mice from H1N1 infection within some dose range.In contrast,its unreasonable treatment fails to effectively relieve infection beyond the appropriate dose.Meanwhile,the mean dead day of low and high dose of SQHT groups were also prolonged to 18.9 ± 4.7 day (P ＜0.01) and 14.4 ± 6.3 day,in consistent with the above result of survival rate.These results illustrated that SQHT improved survival rates and prolonged survival time of virus-infected restraint mice.

Figure 2.Effects of SQHT on the survival rate in influenza-infected mice loaded with restraint stress.Three days before H1N1virus infection,Kunming mice were fixed in a restraint cage for 18 h.Time course of mortality and survival days of each mouse were recorded until the 21st day after viral infection.Data were obtained from 9-12 animals in each group.The difference was considered statistically significant at **P＜ 0.01 vs.“Virus” group; ##P ＜ 0.01,###P ＜ 0.001 vs.“Stress + Virus” group.

Table 1.Effects of SQHT on the survival rate and mean dead day of influenza-infected mice loaded with restraint stress.

SQHT attenuates H1N1-induced pneumonia in restraint-stressed mice

As shown in Figure 3A,the lung index of “Normal”group is 6.15 ± 1.37 mg/g,while “Virus” group raised it to 9.45 ± 0.83 mg/g (P ＜ 0.001) and “Stress+Virus”further increased it to 15.38 ± 0.80 mg/g (P ＜ 0.001).In comparison with “Stress+Virus” group,Ribavirin significantly recovered the lung index to 8.38 ± 0.73 mg/g (P ＜ 0.001).What’s more,the low and high doses of SQHT reduced the lung index to 8.49 ± 0.75 (P ＜0.001) and to 12.9 ± 0.46 mg/g (P＜ 0.05),respectively.Moreover,compared with “Stress+Virus” group,we observed a decrease in lung damage and hemorrhage(Figure 3B and C),and inflammatory cells infiltration(Figure 3D) in SQHT treatment groups at 4 dpi.Consistent with this result,the level of complement C5a in BALF,which is activated during influenza infection and contributes to inflammatory cells recruitment and lung injury [11],was significantly increased in “Stress+Virus” group (P ＜ 0.001),while decreased in Ribavirin (P ＜ 0.001) and low dose of SQHT treatment (P ＜ 0.01) (Figure 3E).Consistent with the result in Figure 2,low dose of SQHT showed a better protection on H1N1-induced pneumonia than high dose of SQHT.These results indicated that SQHT had protective effects against lung inflammation induced by H1N1 virus in restraint-stressed mice.

Figure 3.Effects of SQHT on H1N1-induced lung inflammation in restraint-stressed mice (A) Lung index and(B) lung pathological scores of H1N1 infected mice.(C) Representative images of histologic changes by HE staining of lung (scale bar =100 μm).(D,E) Inflammatory cells numbers and concentrations of C5a in BALF.Data were presented as mean ± SD.*P ＜ 0.05,***P ＜ 0.001 vs. “Normal” group; #P ＜ 0.05,###P ＜ 0.001 vs. “Virus” group;@P ＜ 0.05,@@P ＜ 0.01,@@@P ＜ 0.001 vs. “Stress + Virus” group.

SQHT inhibits H1N1 virus replication in restraint-stressed mice

To investigate the effects of SQHT on virus replication in restraint stressed mice,virus titer in lung tissues were determined at 4 dpi.As shown in Figure 4A-C,no infectious virus was detected in “Normal” group.Compared with the "Virus" group,the "Stress + Virus"group showed a significant increase in virus titer (P ＜0.001) and increased NP gene (P ＜ 0.01) and protein expression.After SQHT and Ribavirin treatment,virus titer in restraint stressed mice was markedly reduced,in consistent with the decreased expression of viral NP gene and protein (Figure 4A-C).Low dose of SQHT showed stronger inhibitory effect.Hence,these results indicated that SQHT treatment could inhibit virus replication in restraint stressed mice.

SQHT improves H1N1-induced IFN-β generation and interferon stimulated genes (ISGs) expression in restraint-stressed mice

It is well known that innate immunity as the first line of defense plays a vital role in protecting against infectious agents,such as influenza virus [12].Previous studies have showed that restraint stress-caused susceptibility to viral infection was strongly linked to diminished innate immunity function and IFN-β generation [8].Hence,we further investigated the effects of SQHT on IFN-β generation and ISG expression.As shown in Figure 5A,restraint stress substantially suppressed H1N1-induced IFN-β generation (P ＜ 0.001),which was improved by low dose of SQHT treatment (P ＜ 0.01).Moreover,low dose of SQHT treatment also significantly augmented the gene expression of MX1 (P ＜ 0.05) and IFITM3 (P＜ 0.05) (Figure 5B and C),two ISGs proteins against influenza infection by inhibiting virus replication [13],in restraint stressed mice.These results revealed that the SQHT-L could decrease the susceptibility to influenza virus in restraint stressed mice by modulating IFN-β-mediated innate immunity.

Figure 4.Effects of SQHT on virus replication in the lung tissues of restraint-stressed mice (A) Virus titer in lung tissues,determined by TCID50 assay.(B)Expression of viral NP gene and (C) protein determined by RT-qPCR and western blotting.Data were presented as mean ± SD.**P ＜ 0.01,***P ＜ 0.001 vs.“Virus”group; #P ＜ 0.05,##P ＜ 0.01,###P ＜ 0.001 vs.“Stress +Virus” group.

Figure 5.Effects of SQHT on IFN-β and ISGs expressions in restraint-stressed mice (A) The level of IFN-β in lung tissues.(B) MX1 and (C) IFITM3 gene expression.Data were expressed as mean ±SD.***P ＜ 0.001 vs.“Normal” group; ###P ＜ 0.001 vs.“Virus” group; @P ＜ 0.05,@@P ＜ 0.01,vs.“Stress + Virus” group.

Discussion

Individuals often exhibit very different clinical outcomes,when exposed to the same pathogen.This variation may be due to pathogen virulence,host genetic makeup or immunity [14].Stress can affect central nervous system,endocrine and immune systems,to play a critical role in the outcome of disease processes [15].Previous studies has shown that restraint stress,a commonly used stressor,could suppress immune function and increase susceptibility to infections [8].Moreover,a study has reported that influenza and pneumonia are the fifth leading cause of mortality in individuals over 50 years old [10] and psychological stress seems to contribute to greater immunological impairments in older adults than in younger adults.Consistent with these studies,our results also demonstrated that restraint stress could weaken the IFN-β generation and increase the susceptibility to H1N1 infection.

Based on restraint stressed mice model,the protective effect of SQHT on H1N1 infection was investigatedin vivo.Our study showed that the administration of SQHT could markedly reduce H1N1-induced mortality,prolong survival time and ameliorate lung inflammation damage in restraint mice.During H1N1 infection,the activation of complement C5a in mice contributed to neutrophil recruitment and lung injury [11],and studies also showed that the complement C5a could suppress IFN-β production in response to Listeriamonocytogenesinfection [16].Our study revealed that SQHT treatment could significantly decrease the concentration of C5a and total inflammatory cell numbers in restrain stressed mice.Moreover,a significant increase of IFN-β and a decrease of H1N1 virus titer were also found in these stressed mice.These results indicated that SQHT treatment improved the IFN-β generation and augmented the expression of ISG in restraint mice,and then inhibited H1N1 virus replication and H1N1-induced inflammation.However,the effect of complement C5a on IFN-β secretion in restraint mice should be further investigated.

It is well known that TCM works in a very different way in human body.TCM synergically interacts with the virus and the host in order to keep them in a balanced state [17] with few side effects,which is totally different from western anti-influenza drugs,such as the neuraminidase inhibitor oseltamivir.SQHT is prepared by the extract fromRadix Ilex Asperllaeand other four natural herbals.Radix Ilex Asprella,which mainly comprises triterpenoid saponin,phenolic acid and phenolic alkaloid compounds,plays a key role in lessening acute respiratory distress syndrome in mice induced by influenza virus [18].From the perspective of Chinese medicine,combination of other four natural herbals are adopted for the improvement of infectionrelated symptoms and reduction of possible toxic effect.However,further studies should be performed to identify the antiviral or immunomodulatory ingredients in SQHT.

Conclusion

Our study demonstrates that SQHT could reduce restraint stress-mediated susceptibility to H1N1 infectionviaimproving IFN-β production.In addition,SQHT also decrease the level of complement C5a to suppress inflammatory cell infiltration,which ameliorates the H1N1-induced lung inflammation and injury.These studies provide a certain basis for the clinical use of SQHT to treat influenza infection.

Acknowledgements

The authors thank Yi-Rong Huang for the help of HPLC fingerprint analysis of SQHT.