Detection of Gene Promoter Methylation and Protein Expression of p21 in Psoriasis

Xin-Mei Liu,Dong Luo,Hui-Qin Wang,Jing-Zhan Zhang,Xiao-Jing Kang?,Wei-Dong Wu?

Department of Dermatology,People’s Hospital of Xinjiang Uygur Autonomous Region,Urumqi,Xinjiang 830001,China.

Abstract

Keywords:psoriasis,p21 gene,promoter,methylation,pyrosequencing

Introduction

Studies worldwide have shown that psoriasis is a polygenic disease associated with complex interactions between genetic and environmental factors that are not yet well defined.1-2Recently,a relationship between the occurrence of psoriasis and abnormalities in DNA CpG island methylation has been demonstrated in samples obtained from patients in the Xinjiang Uygur region of China by pyrosequencing(PSQ).3

The p21 protein,a cyclin-dependent kinase regulator,is mainly distributed in the basal layer of keratinocytes and exhibits a differentiated capacity.4The epigenetic changes of the p21 gene in inflammatory cells,including keratinocytes and T cells,in the pathogenesis of psoriasis indicate that methylation of the p21 gene promoter affects the differentiation,proliferation,and apoptosis of keratinocytes.5-6

In the present study,we determined the methylation status of the p21 gene promoter in patients with psoriasis from Xinjiang Uygur to reveal the potential mechanisms underlying the abnormal activity of the gene.

Materials and methods

Subjects and samples

A total of 34 psoriasis patients without significant renal,hepatic,or other systemic diseases were collected in the Dermatology Department of People’s Hospital of Xinjiang Uygur Autonomous Region,including 20 females and 14 males aged 2-72 years(median,35.8 years).

A total of 37 samples including 15 psoriasis samples and 19 psoriatic uninvolved samples from psoriasis patients were collected for methylation sequencing.Three foreskin and breast tissues from normal healthy persons from the urology department and the pathology department,respectively were used as controls.

The immunohistochemical analysis was conducted on 57 tissue samples including 38 psoriatic tissues and 16 psoriatic uninvolved samples from psoriasis patients,and 3 normal skin samples from healthy control(two foreskin tissue and one breast samples).

For patients in both groups undergoing treatment for psoriasis with systemic agents, a minimum 1-month medication-free period was required before the procedures.The protocols were approved by the Medical Ethics Committee of the People’s Hospital of Xinjiang Uygur Autonomous Region.Each subjects signed the informed consent.

DNA extraction and PSQ analysis

We extracted genomic DNA using the standard method of TES dewaxing with a water bath and phenol-chloroform.Bisulfite modification of genomic DNA (500ng) was performed with anEpiTect?Fast DNA Bisulfite Kit(Qiagen,Hilden,Germany)according to the manufacturer’s recommendations.The promoter methylation of the p21 gene was examined by PSQ.The polymerase chain reaction and sequencing primers were designed by PyroMark Assay Design software(Qiagen).The PSQ assay was designed to evaluate the methylation status of four CpG sites(Fig.1)as follows:

(1)Analysis of the sequence: ACGGGAGCCAACGAAAACAAAACCGCTCGC

(2)Bisulfate modification of the sequence:AYGGGATAAYGAAAATAAAATYGTTYGT

(3)Polymerase chain reaction thermal cycling according to the following regimen:denaturation at 95°C for 5minutes;45 cycles at 95°C for 30 seconds,56°C for 30 seconds,and 72°C for 30 seconds;and a final extension at 72°C for 5minutes.

PSQ was performed on a PyroMark Q96 ID platform(Qiagen)according to the manufacturer’sinstructions.A non-CG cytosine was included in the PSQ region as an internal control to allow us to monitor total bisulfate conversion.The target CpG sites were evaluated using PSQ 96MA 2.1 software(Qiagen),which converts the data to numerical values for peak heights and calculates the proportion of methylation at each base as a C/T ratio.Data analysis was performed using PyroMark Q96 ID version 1.0.

Immunohistochemistry

We used the EnVision two-step immunohistochemistry staining method(Dako,Hamburg,Germany):10%neutral formaldehyde was fixed,paraffin-embedded,sections were dewaxed to hydration,EDTA antigen repair solution was used to repair the antigen,3%H2O2solution was used to eliminate endogenous peroxidase activity,then diluted p21 antibody(rabbit anti-monoclonal antibody,1:100,MaiXin)was dripped over the night at 4°C,and second antibody(enzyme-labeled goat anti-rabbit IgG polymer)was added the next day to incubate at room temperature for 45 min,hematoxylin staining,hydrochloric acid differentiation,neutral gum seals.

Statistical analysis

The data are present as mean±standard deviation.SPSS 17.0 software(SPSS Inc.,Chicago,IL,USA)was used the Chi-square test was used to compare the difference in the p21 gene promoter methylation status between the patients with PSORIASIS and among the three groups.

Results

Baseline characteristics of subjects

The PSQ results showedthat themethylation ratioof CpG1,CpG2,CpG4 in the experimental group was 6%,the methylation ratio of CpG 3 was 20%,and the methylation ratio of CpG2 and CpG4 in the normal controls was 0 and there were no significant differences between psoriasis tissues and psoriatic uninvolved samples and normal skin from healthy control groups(t=-1.885,P＞0.005).

Methylation level of p21 gene in psoriatic tissues

Figure 2 shows an example of methylation of p21 gene in the psoriasis tissues and psoriasis uninvolved samples and normal samples,the methylation level of the p21 gene promoter was not significantly different among the three groups(P=0.204,Table 1).

Immunohistochemistry for p21 protein

Results of immunohistochemistry showed that in psoriatic uninvolved skin,p21 protein is expressed at low levels and is primarily distributed in the basal layer.normal skin from healthy control samples is negative expression,In areas affected by psoriasis,the thickness of the skin and the expression of p21 protein increase(Fig.3).

The p21 proteins expression level in the experimental psoriasis group was 84%(32/38)(Table 2),Bonferroni method is used to adjust the inspection level a=0.0167,and there was not significantly different on the level between the psoriasis group and the psoriatic uninvolved

Figure 1.Four CpG sites in p21 gene promoter.

Figure 2.Pyrograms of the p21 gene in lesional samples from patients with psoriasis and controls.(A)Psoriasis tissues:the mean methylation level of the four CpG sites is 2.75%.(B)Uninvolved skin tissues from psoriasis patients:the mean methylation level of the four CpG sites is 0.(C)Normal skin samples from healthy controls:the mean methylation level of the four CpG sites is 0.The pyrograms include the four CpG sites and the methylation rates.Each p21 gene methylation level is expressed as the mean.

Table 1Promoter methylation of for p21 gene by pyrosequencing analysis.

Table 2The expression of p21 protein in psoriasis by immunohistochemistry.

Figure 3.Immunohistochemistry results for p21 protein.A:p21-positive cells in psoriasis lesions showing brown/yellow particles(nuclei).B:p21-positive cells in psoriatic uninvolved tissue showing brown/yellow particles(nuclei).Positive criteria were scored based on the percentage of positive cells and the intensity of staining.C:p-21 negative in normal skin samples from healthy control

Discussion

The p21 proteins belong to the INK4 kinase family of cyclin-dependent kinase inhibitors,and methylation of the p21 gene promoter is thought to regulate the proliferation of psoriasis.7-10

In the present study,we detected the methylation of the p21 gene promoter, and found there was no difference between the groups,no matter the samples from psoriasis patients or not.When we detected the presentation of p21 protein using immunohistochemistry,we found the p21 presentation was higher in the psoriasis sample than other two groups.The difference on the gene and protein levels of p21 may occur on any step of the entire process of gene transcription into protein translation.

The major mechanism of p21 gene promoter deactivation is methylation of its 5′promoter region(especially methylation of 5′-CpG), which silences transcription.DNA needs to be transcribed by RNA to be translated into protein,and differences in protein expression may not indicate differences on gene level,vice versa.Because of the experimental limitations of the present study including small sample size,an increasing sample size investigation on the role of p21 in the pathogenesis of psoriasis are necessary.

Acknowledgement

This study was supported by the Hospital Project of People’s Hospital of Xinjiang Uygur Autonomous Region (No.20190106).