Pregnane receptor gene polymorphisms， pathogenic bacteria distribution and drug sensitivity， and TCM dyndrome differentiation in patients with cholelithiasis

Yi-Qiang Xie， Jing-Zhe Zhang， Hua Zhang， Lei Peng， Shuang Zhou， Li-Zhuo Li， Bang-Jiang Fang， Chuan-Zhu Lyu*

1College of Traditional Chinese Medicine， Hainan Medical University， Haikou， Hainan， China

2Department of General Surgery， Longhua Hospital Shanghai University of TCM， Shanghai， China

3International Nursing School， Hainan Medical University， Haikou， Hainan， China

4Traumatology Department， Affiliated Hospital of Hainan Medical University， Haikou， Hainan， China

5College of Traditional Chinese Medicine， Second Military Medical University， Shanghai， China

6Emergency Department， Longhua Hospital Shanghai University of TCM， Shanghai， China

Pregnane receptor gene polymorphisms， pathogenic bacteria distribution and drug sensitivity， and TCM dyndrome differentiation in patients with cholelithiasis

Yi-Qiang Xie1#， Jing-Zhe Zhang2#， Hua Zhang3， Lei Peng4， Shuang Zhou5， Li-Zhuo Li4， Bang-Jiang Fang6*， Chuan-Zhu Lyu4*

1College of Traditional Chinese Medicine， Hainan Medical University， Haikou， Hainan， China

2Department of General Surgery， Longhua Hospital Shanghai University of TCM， Shanghai， China

3International Nursing School， Hainan Medical University， Haikou， Hainan， China

4Traumatology Department， Affiliated Hospital of Hainan Medical University， Haikou， Hainan， China

5College of Traditional Chinese Medicine， Second Military Medical University， Shanghai， China

6Emergency Department， Longhua Hospital Shanghai University of TCM， Shanghai， China

Accepted 15 March 2016

Available online 20 April 2016

Cholelithiasis

Cholesterol gallstone disease

Drug resistance test

Pregane X receptor

Polymorphism

Traditional Chinese medicine syndromes

Objective: To investigate the distribution of pathogens and drug resistance in bile and the association between the pregane X receptor （PXR） gene polymorphisms， traditional Chinese medicine （TCM） syndromes and the risk of cholesterol gallstone disease （CGD）. Methods: A total of 392 samples were enrolled in this study from January 2014 to February 2015， among which 192 patients were with CGD， and 200 samples were healthy. Strains were isolated and susceptibility testing was the disk diff usion method susceptibility testing. The patients were divided into hepatochlic hygropyrexia， stagnation of liver-qi， and the accumulation of damp. The PXR gene polymorphisms were analyzed by polymerase chain reaction-restriction fragment length polymorphism. The association between the PXR gene polymorphisms and the risk of CGD was examined by logistic regression analysis. Results: A total of 192 cases were detected in 230 of bile culture pathogens， including Gram-negative bacteria 133 （57.83%）， Gram-positive bacteria 76 （33.04%）， and fungi 21 （9.13%）. The top five pathogens were Escherichia coli， Klebsiella pneumoniae， Enterococcus faecalis， Candida albicans， and Enterococcus feces， of which 110 cases was of single infection， 48 cases of mixed infection of two strains， eight cases of mixed infection of three bacteria. Among 59 Escherichia coli， the yield extended-spectrum beta-lactamases had 40（67.80%）. The hepatochlic hygropyrexia was the most TCM syndrome， followed by stagnation of liver-qi， and the accumulation of damp was least. Diff erent pathogens and the rs6785049 genotypes distributed diff erently in cholelithiasis patients with diff erent TCM syndromes （P＜0.05）. In hepatochlic hygropyrexia patients the Gram-negative bacteria was most. There was signifi cant diff erences between CGD group and control group in rs6785049 （P＜0.001）. Comparison with wild-type portable GG， GA genotype increased the risk of the occurrence of gallstones （OR=0.40，95%CI: 0.16-0.79）； likewise， carrying the GA + AA genotype also increased the risk （OR=0.38，95%CI: 0.19-0.81）. There was no signifi cant diff erences in rs2276707， rs3814055 site polymorphic loci alleles in CGD group and control group. Conclusions: In the treatment of cholelithiasis， bile samples should be collected for bacterial culture and sensitivity test， and drugs should be strictly chosen based on the results. The rs6785049 polymorphisms in PXR gene may increase the risk of gallstones ontogeny， and gallstones can be early detected and prevented by detecting genotypes. rs6785049 polymorphisms in PXR gene may has relationship with TCM syndromes.

1. Introduction

Cholelithiasis， also known as cholesterol gallstone disease，involves the formation of gallstones that disrupt the proper draining of bile from the gallbladder. Symptoms include a swollen， painful abdomen， radiating pain， yellowing skin， and sometimes fever. Improved living conditions and nutritional status among the Chinese has contributed to an increase in cholelithiasis in recent years［1］. The formation of gallstones has been linked to a variety of environmental and dietary factors， and some studies suggest that genetics also play a role［2］. Specifi cally， the pregnane X receptor （PXR） has been found to be closely associated with cholelithiasis， as PXR gene polymorphisms have been shown to reduce the risk of gallbladder and bile duct stone formation［3-6］. PXR is a member of the nuclear receptor subfamily and numerous studies have found that alterations to the PXR gene can affect cholesterol metabolism， reduce gallbladder motility， infl uence the excretion of bile and cholesterol，and regulate the cholesterol saturation index so as to affect the formation of gallstones［3，7-11］.

According to traditional Chinese medicine （TCM）， chronic gallstone formation is the result of qi stagnation， blood stasis， and accumulation of fl uid in the body， or dampness［12］. TCM suggests that the pathogenesis of chronic cholelithiasis involves the invasion of exogenous factors via skin， hair， or interstices of the fl esh into the interpleuro-diaphragmatic space， where they then accumulate and interfere with bile drainage［13］. The accumulated and stagnated bile then leads to the formation of stones. Emotional disorders may also contribute to the stagnation of the liver qi and qi depression in the gallbladder， further resulting in stagnated bile. Additional causes may be related to excess phlegm， blood extravasation， or roundworm stagnation in the liver and gallbladder， causing poor bile excretion and coagulation into stones. These factors may act alone， or in combination.

The relationship between bile duct bacterial strains and TCM syndrome diff erentiation related to cholelithiasis was assessed in this study， and the role of PXR gene polymorphisms in the development of cholelithiasis was also determined. Bile bacterial cultures and blood samples collected from cholelithiasis patients were compared to samples from healthy individuals and the bacteria were subjected to antibiotic screening.

2. Materials and methods

2.1. Study participants

Samples from 192 patients with cholelithiasis treated in our hospital between January 2014 and February 2015 were selected for this study. The patient group was made up of 110 males （57.29%）and 82 females （42.71%）， with an average age of （61.18±9.72）years. The diagnosis of all 192 patients was clinically confirmed，and 200 healthy individuals receiving physical examination during the same period in our hospital were selected as a control group. The control group was made up of 118 males （59.00%） and 82 females（41.00%）， with an average age of （60.35±8.16） years. There were no statistically signifi cant diff erences in gender or age between the case group and the control group. All patients and healthy participants were Han Chinese. This study was approved by the Ethics Committee of Affi liated Hospital of Hainan Medical University and informed consent was obtained from all participants.

2.2. Identification of bacterial strains

A total of 4-6 mL bile were collected from patients and placed in sterile culture tubes. Each sample was divided into two portions；one to be used for bacterial culture and drug sensitivity testing and another for anaerobic culture. Strain identifi cation was performed according to the National Clinical Laboratory Procedures manual. A VITEK-2 Compact Automated Bacteria Analyzer （bioMerieux，F(xiàn)rance） was used to perform drug sensitivity testing using a paper strip. Drug sensitivity determination was performed in accordance with the Executive Standard for Sensitivity Testing for Antimicrobial Drugs published by the Clinical and Laboratory Standards Institute.

2.3. Antibiotic resistance test

Antibiotic resistance was determined among Escherichia coli and Klebsiella pneumoniae samples by testing for the presence of extended-spectrum beta-lactamases （ESBLs） using the disk diff usion test recommended by the Clinical and Laboratory Standards Institute.

2.4. PXR gene polymorphism determination

Genomic DNA was extracted using phenol/chloroform and polymerase chain reaction （PCR） restriction fragment length polymorphism was used to determine the PXR gene polymorphism. Genotyping was performed as follows: rs2276707: upstream PCR primer 5’CTGAGAAGCTGCCCCTCGAT3’， downstream PCR primer: 5’CTCATGCAGCTGCAGCTTCTTC3’； annealing temperature: 57 ℃； restriction endonuclease: MboⅠ. rs6785049: upstream primer: 5’CCCATAATCCAGAAGTTGGGCG3’，downstream primer: 5’GCAGAGCTGTCTGCTGGGTTGT3’；a n n e a l i n g t e m p e r a t u r e : 5 1 ℃； r e s t r i c t i o n endonuclease: Hin6Ⅰ. rs3814055: upstream primer 5’TCATTTTTTGGCAATCCCAGGAT3’， downstream primer: 5’TCTGGCAACAGTAAAGCAGGGG3’； annealing temperature: 50 ℃； restriction endonuclease: MboⅠ.

Each PCR reaction totaled 20 μL， and contained 10 μmol/L of primers （0.3 μL）， 0.8 μmol/L dNTPs， 1.5 μmol/L MgCl2， 80 μg/ μL genomic DNA， 0.5 unit of REDTaq DNA polymerase， and 15.7 μL H2O. A PTC 200 Therma Cycler （Promega Corporation， USA）was used to perform the reactions. Each PCR reaction involved denaturing at 95 ℃ for 5 min， followed by 35 cycles at 95 ℃，each for 30 s， annealing at 70 ℃， and extension at 70 ℃ for 45 s. For restriction fragment length polymorphism analysis， the PCR products of rs2276707， rs6785049， and rs3814055 were digested with MboⅠ， Hin6Ⅰ， and MboⅠ endonuclease， respectively. PCR products were electrophoresed in 2% sepharose gel and stained with ethidium bromide for band visualization.

2.5. TCM syndrome differentiation

Cholelithiasis patients were divided into three types according to the Guiding Principles for Clinical Research on New Drugs of TCM and Specifications for TCM Syndrome， published by the ChineseMinistry of Health. Patients were determined to have dampnessheat syndrome of the liver and gallbladder based on the presence of yellow urine， bitter taste in the mouth， fullness and distention or paroxysmal pain of the lateral thorax， occasional unbearable angina extending to back and shoulder， loss of appetite， yellowness of body and eye， constipation， yellow and greasy tongue coating， and wiry pulse. Hepatic qi stagnation was determined based on the presence of signifi cant angina at the right lateral thorax or under the xiphoid process， lateral thorax pain or angina radiating to the back， nausea，vomiting， loss of appetite， bitter taste， dry mouth， aversion to greasy foods. Some patients also suff ered from fever， fi ery temperament，irritability， hiccups， belching， dark red tongue， thin yellow or thin white tongue coating， and thread， slippery pulses. Noxious dampness accumulation was determined by the presence of fever and aversion to cold or alternating episodes of fever and chills， unbearable pain below the right lateral thorax， abdominal tenderness， tension of abdominal muscles， bitter taste， dry throat， yellow body and eyes，cold limbs， in severe cases， coma and delirium， red or crimson tongue， yellow dry tongue coating， and slippery， rapid pulses.

2.6. Statistical analysis

Epidata 3.1 （Epidata Software， Denmark） was used to create a database for data entry using the double entry method， followed by logic checks. SAS 9.2 （SAS Institute， USA） was used for data processing. The statistical methods used to analyze data were the X2test and non-conditional logistic regression analysis. A P＜0.05 was considered to be statistically signifi cant.

3. Results

3.1. Pathogenic bacteria distribution

A total of 230 strains of pathogenic bacteria were detected among the bile cultures， including 133 strains of Gram-negative bacteria（57.83%） and 76 strains of Gram-positive bacteria （33.04%）， as well as 21 strains of fungus （9.13%）. The fi ve most common organisms were Escherichia coli， Klebsiella pneumoniae， Enterococcus faecalis，Candida albicans， and Enterococcus faecium. There were 110 cases of single-fungus infection， 48 cases of mixed infection of two bacteria，and eight cases of mixed infection involving at least three types of bacteria and/or fungus （Table 1）.

3.2. Antibiotic resistance among bile bacteria cultures

Fifty-nine strains of Escherichia coli were identified among the cholelithiasis patients and 40 tested positive for ESBLs （67.8%）. Gram-negative bacteria were resistant to ampicillin， nitrofurantoin，erythromycin， ciprofloxacin， and ceftriaxone， while remaining sensitive to ertapenem， tigecycline， and imipenem. Enterococcus were highly sensitive to teicoplanin， linezolid， nitrofurantoin， and tigecycline. Enterococcus faecalis was highly resistant to clindamycin and quinupristin， while Enterococcus faecium was highly sensitive to erythromycin， clindamycin， levofloxacin， and ciprofloxacin. Complete drug resistance profiles among Gram-negative and Enterococcus bacteria were shown in Tables 2 and 3.

Table 1Bile pathogen distribution in cholelithiasis disease.

Table 2Antibiotic resistance of Gram-negative bacilli.

Table 3Antibiotic resistance of enterococci.

3.3. Correlation of bacterial strain and pregnane receptor gene polymorphism with TCM syndrome identification

TCM diagnostic factors identifi ed dampness and heat in the liver and gallbladder as the prevailing syndrome of cholelithiasis patients，followed by hepatic qi stagnation， with the smallest number of patients showing signs of noxious dampness accumulation. Diff erent bacterial strains from cholelithiasis patients were significantly associated with the syndromes identified by TCM （P＜0.05）， and Gram-negative bacteria were detected in the largest number of patients with dampness and heat of the liver and gallbladder.

The rs6785049 genotype of the PXR gene was found to be signifi cantly associated with TCM syndromes （P＜0.05）， while there was no statistically significant difference observed in the distribution of the rs2276707 and rs3814055 genotype. The results were shown in Table 4.

3.4. PXR gene polymorphism linked to cholelithiasis

The only genotype to show significant association with cholelithiasis diagnosis was the rs6785049 polymorphism（P＜0.001）， and after combining GA and AA， there was still statistically signifi cant diff erence between the combined genotype and GG （P＜0.001）. Logistic regression analysis indicated that the GA genotype within the rs6785049 polymorphism carried an increased risk of gallstones compared to those carrying the GG wild type genotype （OR=0.40， 95%CI: 0.16-0.79）. Individuals carrying the GA+AA genotype were also at increased risk of gallstones（OR=0.38， 95%CI: 0.19-0.81）. There was no evidence that the rs2276707 or rs3814055 gene polymorphism was correlated with risk of cholelithiasis. The results were shown in Table 5.

Table 4TCM syndromes， pathogens， and PXR gene polymorphism ［（n）%］.

Table 5Genotype and allele frequencies among cases and controls and their association with cholelithiasis risk ［（n）%］.

4. Discussion

Culturing of the bile bacteria collected in this study revealed a high rate of mixed infections （56 cases）， higher than that previously reported in Chinese patients［14］， and a low rate of fungal infection. Our discovery of Enterococcus faecalis and Enterococcus faecium in the bile of cholelithiasis patients confi rm previous fi ndings［15］. Our analysis revealed a number of ESBLs-producing bacteria and the Gram-negative bacteria displayed resistance to a variety of antimicrobial agents while remaining sensitive to ertapenem，tigecycline， and imipenem， suggesting that these may be the most useful in treating biliary tract infections caused by Enterobacteriaceae. Our results also support the practice of collecting and culturing bile samples for drug sensitivity testing as part of routine cholelithiasis treatment. Antibiotics should be selected carefully， so as to avoid double infection and reduce the emergence of resistant strains of bacteria. It was found that the largest proportion of cholelithiasis patients had dampness-heat of the liver and gallbladder according to TCM， and that pathogenic bacteria were differently distributed in cholelithiasis patients with different TCM syndromes. Gramnegative bacteria were detected in the largest proportion of patients with dampness-heat of the liver and gallbladder， suggesting that the presence of dampness and heat in the liver and gallbladder may be a result of Gram-negative bacteria infection. Diff erent genotypes of the PXR gene were diff erently distributed in cholelithiasis patients with diff erent TCM syndromes， suggesting that the PXR rs6785049 genotype could play a role in determining how cholelithiasis manifests in diff erent individuals.

Analysis of the rs2276707， rs3814055， and rs6785049 polymorphisms revealed a correlation between the rs6785049 polymorphism and cholelithiasis diagnosis， along with statistically significant differences in GG， GA， and AA genotype distribution within the rs6785049 polymorphism. After combining GA and AA， there was still a signifi cant diff erence between the combined genotype and GG， and logistic regression analysis showed that compared to those carrying the GG wild type allele， individuals with the GA genotype were at increased risk for developing gallstones（OR=0.40）； similarly， those carrying with GA+AA genotype were also at increased risk of gallstones （OR=0.38）. Findings have indicated that bile acids can activate PXR， and the activated PXR can reduce cholestasis， bile acid， and maintain homeostasis of bile acids［16-19］. The mechanism for this may involve PXR induction of fi broblast growth -19 gene expression， thereby strengthening the recovery of bile acids， so as to prevent the formation of gallstones. Bacterial cultures of bile specimens and blood samples collected from cholelithiasis patients were analyzed and bacteria types，antibiotic sensitivity of the bacteria， and PXR gene polymorphisms to samples from healthy patients were compared. The pathogenic bacteria distribution in patients’ bile and antibiotic resistance characteristics in relation to TCM syndrome differentiation were also evaluated. The results of our study support the timely collection of bile samples for bacterial culture， drug sensitivity testing and the careful selection of antibiotics to prevent double infection and reduce the emergence of resistant strains. Our results also support a role for PXR gene rs6785049 polymorphisms in infl uencing the expression of the PXR gene and the development of gallstones，providing an opportunity for early detection and prevention at an early stage through genotype detection. It is also found that gallstone development is associated with TCM syndrome differentiation，providing a theoretical basis for the prevention， diagnosis， and treatment of cholelithiasis.

Conflict of interest statement

We declare that we have no confl ict of interest.

［1］ Gong Y， Li S， Tang Y， Mai C， Ba M， Jiang P， et al. Cholelithiasis and risk of pancreatic cancer: systematic review and meta-analysis of 21 observational studies. Cancer Causes Control 2014； 25（11）: 1543-1551.

［2］ Castro-Torres IG， De la O-Arciniega M， Bravo-Duarte GA， Gallegos-Estudillo J， Domínguez-Ortíz Má， Martínez-Vázquez M. Intestinal and hepatic Niemann-Pick C1L1 proteins: future therapeutic targets for cholesterol gallstones disease？ Eur J Pharmacol 2014； 728（1）: 77-81.

［3］ Kotta-Loizou I， Patsouris E， Theocharis S. Pregnane X receptor polymorphisms associated with human diseases. Expert Opin Ther Targets 2013； 17（10）: 1167-1177.

［4］ Jonker JW， Liddle C， Downes M. FXR and PXR: potential therapeutic targets in cholestasis. J Steroid Biochem 2012； 130（3）: 147-158.

［5］ Gao J， Xie W. Targeting xenobiotic receptors PXR and CAR for metabolic diseases. Trends Pharmacol Sci 2012； 33（10）: 552-558.

［6］ Chai X， Zeng S， Xie W. Nuclear receptors PXR and CAR: implications for drug metabolism regulation， pharmacogenomics and beyond. Expert Opin Drug Met 2013； 9（3）: 253-266.

［7］ Beuers U， Trauner M， Jansen P， Poupon R. New paradigms in the treatment of hepatic cholestasis: from UDCA to FXR， PXR and beyond. J Hepatol 2015； 62（suppl 1）: S25-S37.

［8］ Ma X， Chen J， Tian Y. Pregnane X receptor as the ‘sensor and eff ector’ in regulating epigenome. J Cell Physiol 2015； 230（4）: 752-757.

［9］ Je YT， Sim WC， Kim DG， Jung BH， Shin HS， Lee BH. Expression of CYP3A in chronic ethanol-fed mice is mediated by endogenous pregnane X receptor ligands formed by enhanced cholesterol metabolism. Arch Toxicol 2015； 89（4）: 579-589.

［10］ Sui Y， Helsley RN， Park SH， Song X， Liu Z， Zhou C. Intestinal pregnane X receptor links xenobiotic exposure and hypercholesterolemia. Mol Endocrinol 2015； 29（5）: 765-776.

［11］ Spruiell K， Jones DZ， Cullen JM， Awumey EM， Gonzalez FJ， Gyamfi MA. Role of human pregnane X receptor in high fat diet-induced obesity in premenopausal female mice. Biochem Pharmacol 2014； 89（3）: 399-412.

［12］ Dechang L. Chinese medicine treatment of cholecystitis and cholelithiasis. Chinese J Ethnomed 2012； 19（21）:116.

［13］ Ma J， Guo L. Treating cholelithiasis in traditional Chinese medicine. Clin J Chinese Med 2014； 6（23）: 143-144.

［14］ Wu T， Zhang Z， Liu B， Hou D， Liang Y， Zhang J， et al. Gut microbiota dysbiosis and bacterial community assembly associated with cholesterol gallstones in large-scale study. BMC Genomics 2013； 14: 669.

［15］ Gotthardt DN， Weiss KH， Rupp C， Bode K， Eckerle I， Rudolph G， et al. Bacteriobilia and fungibilia are associated with outcome in patients with endoscopic treatment of biliary complications after liver transplantation. Endoscropy 2013； 45（11）: 890-896.

［16］ He J， Nishida S， Xu M， Makishima M， Xie W. PXR prevents cholesterol gallstone disease by regulating biosynthesis and transport of bile salts. Gastroenterology 2011； 140（7）: 2095-2106.

［17］ Zeng H， Li D， Qin X， Chen P， Tan H， Zeng X， et al. Hepato-protective effects of Schisandra sphenanthera extract against lithocholic acidinduced cholestasis in mice are associated with the activation of RXR pathway and promotion of liver regeneration. Drug Metab Dispos 2015. doi: 10.1124/dmd.115.066969.

［18］ Di Ciaula A， Wang DQH， Bonfrate L， Portincasa P. Current views on genetics and epigenetics of cholesterol gallstone disease. Cholesterol 2013； 2013（2）: 298421. doi:10.1155/2013/298421.

［19］ Fiorucci S， Distrutti E， Ricci P， Giuliano V， Donini A， Baldelli F. Targeting FXR in cholestasis: hype or hope. Expert Opin Ther Targets 2014； 18（12）: 1449-1459.

ent heading

10.1016/j.apjtm.2016.03.001

15 January 2016

Chuan-Zhu Lyu， Professor， M.D.， Traumatology Department，Affi liated Hospital of Hainan Medical University， Haikou， Hainan， China.

E-mail: 308213740@qq.com

Bang-Jiang Fang， Professor， M.D.， Emergency Department， Longhua Hospital Shanghai University of TCM， Shanghai， China.

E-mail: fangbji@163.com

Foundation project: This study was supported by the National Science Foundation of China （30672698）.

#The fi rst two authors contributed equally to this work.

in revised form 20 February 2016

ARTICLE INFO

Article history: