Bone Marrow Urokinase Plasminogen Activator Receptor Levels are Associated with the Progress of Multiple Myeloma△

Li-hong Shou*， Dan Cao， Xiao-hui Dong， Qiu Fang，Bao-lian Xu， and Ju-ping Fei

Department of Hematology， Huzhou Central Hospital， Huzhou，Zhejiang 313003， China

?

Bone Marrow Urokinase Plasminogen Activator Receptor Levels are Associated with the Progress of Multiple Myeloma△

Li-hong Shou*， Dan Cao， Xiao-hui Dong， Qiu Fang，Bao-lian Xu， and Ju-ping Fei

Department of Hematology， Huzhou Central Hospital， Huzhou，Zhejiang 313003， China

multiple myeloma； urokinase-type plasminogen activator receptor；bone marrow； urokinase

Objective To determine the mRNA and protein levels of urokinase plasminogen activator receptors（uPAR） in bone marrow fluid and bone marrow tissue from multiple myeloma （MM） patients and assess association of uPAR level with prognosis of MM.

Methods uPAR levels in bone marrow fluid of 22 MM patients at the stable and progressive stages and 18 iron deficiency anemia patients with normal bone marrow （control） were examined by ELISA. Furthermore， uPAR expression in bone marrow tissue was investigated by RT-PCR and Western blot，respectively. The distribution of uPAR in MM cells was examined using immunofluorescence staining. The pathological changes in different stages of MM patients were studied by HE staining.

Results uPAR level in bone marrow fluid of MM patients （1.52±0.32 μg/ml） was found to be higher than that in the control group （0.98±0.15 μg/ml）. Interestingly， uPAR protein （0.686±0.075 vs. 0.372±0.043， P＜0.05） and mRNA （2.51±0.46 vs. 4.46±1.15， P＜0.05） expression levels of MM patients at the progressive stage were significantly higher than those at the stable stage. The expression of uPAR in MM bone marrow was confirmed by immunofluorescence staining. Moreover， HE staining revealed a great increased number of nucleated cells and severe impairment of hematopoietic function in the bone marrow of patients with progressive-stage myeloma.

Conclusion Our study reveals that uPAR expression is positively correlated with the development and progress of MM.

Chin Med Sci J 2016； 31（3）：155-160

MULTIPLE myeloma （MM） is a fatal hematologic malignancy characterized by a neoplastic proliferation of plasma cells and the secretion of monoclonal Ig.1，2The presenting symptoms of MM includes pathologic fractures， recurrent infection，anemia， and renal failure. It accounts for 1% of all malignant tumors and 13% of all hematological malignancies.3MM is commonly found in people aged between 50 and 70 years regardless of gender. It is estimated that， with the aging of population the number of MM patients in China will rise within the next few years，4which could aggravate the financial burden due to the medical care and compromise the quality of life of suffered people as well. Early diagnosis of MM is believed to be the key to treat and cure this devastating disease.

The urokinase type plasminogen activation （uPA）system， consisting of uPA and its receptor uPAR， plays a key role in tissue remodelling and extracellular matrix（ECM） degrading.5，6uPA has been demonstrated as a prognostic marker for breast cancer.7，8Moreover， the essential role of both uPA and uPAR in the evasion and metastasis of cancers has been confirmed，5，6which made this system an attractive target for cancer treatment. The value of uPAR as a prognostic marker was also demonstrated in various types of cancers including acute leukemia，breast cancer， and MM.8，9Intriguingly， it has been showed that the plasma level of uPAR was positively correlated with the prognosis of MM.10However， the level of uPAR in the bone marrow of MM patients and its association with MM prognosis are not reported. In fact， bone marrow， the hematopoietic center in our body， is closely related to pathogenesis of MM， as the presence of large numbers of neoplastic plasma cells is one of the characters of MM. Importantly， the microenvironment of bone marrow is critical to the growth and survival of bone marrow cells.11Therefore， it will be valuable to investigate whether uPAR level in bone marrow can serve as a new prognostic marker for MM patients compared with that in plasma. In this study，we measured the level of uPAR in both bone marrow and its fluid from MM patients and further assessed the association of uPAR with the prognosis of MM progression and its chemotherapeutic treatment.

PATIENTS AND METHODS

Patient eligibility

The bone marrow samples were collected from 22 patients who were diagnosed with MM between years 2009 and 2014 at Huzhou Central Hospital. All patients met the diagnostic criteria described in Standard of Diagnosis and Therapeutic Effect of Hematopathy by Zhang and Shen.12The median age at diagnosis was 57 （range 39-79） years and 13 （59%） patients were male. Eight patients were newly diagnosed with MM and 14 were retreated including 5 relapsed/refractory cases， 6 cases who achieved partial remission， and 3 cases with complete response. The duration of the disease was from 1 to 67 months with an average of 16.4 months. Informed consent was obtained from all subjects before the study.

The clinical staging of patients was determined based on treatment response.13Patients were classified as being in the stable stage if they are responsive to therapies （10 cases， 45%）， or being in progressive stage if they do not respond to treatment （12 cases， 55%）.

In addition， uPAR levels of 5 newly diagnosed patients after chemotherapy were compared with before therapy.

Eighteen iron deficiency anemia patients with normal bone marrow were served as the control. Median age of the control group was 52 （range 38-76） years and 11 （61%）patients were male.

ELISA

An aliquot of 2 ml bone marrow fluid was mixed within 5% EDTA under sterile condition and centrifuged at 4500×g for 10 minutes. The supernatant was then preserved at -80°C for future use. uPAR level was evaluated with human uPAR ELISA kit （R&D system， Minneapolis， USA） according to manufacturer's protocol. Colour developed was read at 450 nm and the optical density value is directly proportional to the concentration of uPAR in the samples （μg/ml）.

Western blot

Bone marrow tissue was homogenized and lysed in RIPA buffer （Beyotime Institute of Biotechnology） containing protease inhibitors. After centrifugation （30000×g， 4°C）for 10 minutes， the supernatants were collected and denatured by SDS sample buffer. Equal amounts of protein samples were separated by SDS-PAGE gel and transferred onto a nitrocellulose membrane. After blocking in 10% milk for 1 hour at room temperature， the membranes were incubated with rabbit anti-human uPAR or mouse antihuman β-actin antibody （Santa Cruz， USA， 1：1000 dilution）at 4°C overnight. The band was detected after the membrane was incubated with horseradish peroxidase（HRP）-conjugated goat anti-rabbit IgG or goat anti-mouse IgG （Santa Cruz） for 2 hours at room temperature by using NBT/BCIP （Beyotime Institute of Biotechnology）. The blot was photographed with a fluorescence microscope （Carl Zeiss， German） and the density of the bands on the membrane was quantified by Image J software （gelimaging system JS-680D， Hangzhou Deju Instrument Equipment Co.， Ltd.， Zhejiang， China）. β-actin served as a loading control.

RT-PCR

Total RNA was extracted from bone marrow tissues using Trizol （Takara， Dalian， China）. RNA concentration was determined and equal amounts of RNA samples obtained were reversely transcribed into cDNA using cDNA synthesis kit （Takara）. The resulting cDNAs were amplified by using PCR. The specific primer sequences of uPAR and β-actin were as follows： uPAR （forward： 5'GCCCAATCCTGGAGCTT GA3'； reverse： 5'TCCCCTTGCAGCTGTAACACT3'） and β-actin（forward： 5'CTCCATCCTGGCCTCGCTGT3'； reverse： 5'GCTG TCACCTTCACCGTTCC3'） and synthesized by Takara. For PCR reaction， one cycle of denaturation at 95°C for 30 seconds，annealing at 55°C for 30 seconds， and elongation at 60°C for 30 seconds was performed. A total of 40 cycles were performed for both uPAR and β-actin. To assess the level of uPAR transcription， the Ctvalue of uPAR was normalized to the value of its corresponding housekeeping gene β-actin. The experiments were repeated for 3 times with triplicates in each group.

Immunofluorescence staining

The paraffin sections （3-μm thickness） of the bone marrow were fixed in acetone at 4°C for 10 minutes. Endogenous peroxidase was eliminated for 5 minutes with 3% hydrogen peroxide. The sections were blocked with 3% bovine serum albumin for 30 minutes followed by incubation with anti-uPAR specific antibody （Santa Cruz， USA， 1：100 dilution） at 4°C overnight. After incubation with fluorescein isothiocyanate （FITC）-conjugated goat anti-rabbit secondary antibody for 30 minutes， the nucleus was stained with 4'， 6-diamidino-2-phenylindole （DAPI） for 20 minutes. The sections were immersed in 0.5 mol/L Na2CO3containing 50% glycerol and detected under a fluorescence microscope. The positive expression of uPAR showed blue fluorescence with immunofluorescence staining.

HE staining

Paraffin-embedded tumor tissue sections were fixed in 4% paraformaldehyde. Subsequently， the sections were dewaxed， washed and stained with hematoxylin-eosin （HE）. The pathological changes were observed under a highpower light microscope.

Statistical analysis

The data were expressed as mean±standard deviation and analyzed using IBM SPSS 19.0 software. Comparisons between two groups were carried out with student's t test， and comparisons among three or more groups with one-way analysis of variance. P＜0.05 was considered statistically significant.

RESULTS

uPAR level in bone marrow fluid

ELISA revealed higher levels of uPAR in bone marrow fluid from MM patients （1.52±0.32 μg/ml） compared with the control group （0.98±0.15 μg/ml， P＜0.05）. uPAR level of MM patients at the progressive stage was significantly higher than that at the stable stage （1.79±0.43 vs. 1.19±0.22 μg/ml， P＜0.01）. However， no significant difference in uPAR levels was detected between the control group and MM patients at the stable stage （P＞0.05）. In addition， uPAR levels in bone marrow fluid decreased markedly after chemotherapeutic treatment （1.50±0.27 vs. 1.13±0.25 μg/ml， P＜0.05）.

uPAR level in bone marrow

Western blot showed that uPAR level in the bone marrow tissues obtained from MM patients was markedly higher than that from the control group （0.425±0.027 vs. 0.236± 0.031， P＜0.05； Fig. 1）. Importantly， higher levels of uPAR were observed in patients at the progressive stage compared with ones at the stable stage （0.686±0.075 vs. 0.372±0.043，P＜0.05）. Taken together， these results suggest an association between the level of uPAR and progression of MM.

RT-PCR displayed the bone marrow from MM patients expressed much higher level of uPAR mRNA （Fig. 2A，P＜0.05）. Specially， uPAR mRNA levels of MM patients at the stable and progressive stage were 2.51±0.46 and 4.46±1.15 folds higher respectively than that of the control group （Fig. 2A， all P＜0.05）. Additionally， we found that chemotherapy could significantly reduce uPAR mRNA expression （P＜0.05， Fig. 2B）.

As shown in Fig. 3， immunofluorescence assay revealed weak signals both on the membrane and in the cytoplasm of bone marrow cells obtained from MM patients. The signals after chemotherapy group were weaker than those of the refractory or before chemotherapy groups.

Figure 1. Western blot analysis of uPAR protein level in the bone marrow of MM patients. uPAR： urokinase plasminogen activator receptors；MM： multiple myeloma.

Pathological changes

HE staining revealed increased number of proliferating monocytes and plasma cells， and nodular infiltration was seen in the bone marrow tissues of MM patients at the progressive stage. No obvious fibrosis was found in the tumor tissues. In contrast， bone marrow tissues from patients at the stable stage exhibited clearly decreased number of nucleated cells. The number of nucleated cells，monocytes and plasma cells was normal in bone marrow tissue from iron deficiency anemia patients； in addition， no fibrosis was observed. （Fig. 4）

Figure 2. RT-PCR analysis of mRNA expression of uPAR in bone marrow obtained from MM patients. Data are expressed as mean±standard deviation.

Figure 3. Immunofluorescence staining of bone marrow cells from patients with recurrent MM （A）， before chemotherapy （B）， and after chemotherapy （C） to detect uPAR expression. ×100

Figure 4. Histological images of bone marrow tissues from MM patients at the progressive （A） and stable stages （B）， and iron deficiency anemia patients （C）. HE staining ×200

DISCUSSION

uPAR consists of three-domains （D1， D2 and D3） with molecular weight around 55-60 kD and is attached to the cell surface by a glycolipid anchor. uPAR plays a pivotal role in the degradation of ECM and was found to be involved inthe interaction of ECM with cells and also cellular signal transduction.14Emerging evidence shows that uPAR is highly expressed and implicated in the metastasis， invasion，proliferation， and survival of various types of cancers by degrading ECM and promoting angiogenesis.15Studies also showed that the microenvironment of tumors could induce uPAR expression， which in turn activates gelatin-degrading enzyme.16In addition， it was reported that the level of uPAR is closely related to the progression of glioma， nonsmall cell lung cancer， and colorectal cancer.17-19Likewise，uPAR was revealed to be closely associated with the prognosis of large cell lung cancer in which its high expression could predict vasculogenic mimicry and migration.20The prognostic value of uPAR was also demonstrated in bladder cancer.21

In the present study， we found that uPAR expression was significantly higher in bone marrows fluid from MM patients when compared to the control group. Furthermore，we classified the patients into two stages including stable and progressive stages， and compared uPAR level between them. Our results showed that the expression of uPAR in bone marrow fluid of progressive stage patients were increased to 1.5 folds high compared with those in the stable stage. uPAR levels were relatively lower in the early stage oral squamous carcinoma patients compared to the advanced stage patients.22This finding was further supported by our results that chemotherapy could largely attenuate uPAR expression. Subsequently， we evaluated both the mRNA and protein levels of uPAR in bone marrow. Consistently， uPAR mRNA and protein levels were significantly higher in MM patients at the progressive stage than those at the stable stage （Figs. 1， 2）， and chemotherapy significantly reduced the expression of uPAR in bone marrow from MM patients （Fig. 2）. Hou et al23reported that uPAR activation can promote hepatic cancer progression. uPAR was also reported to interact with transforming growth factor-β， and promote the progression and metastasis of MM.24Further， we determined the expression of uPAR in bone marrow using immunofluorescence staining，and observed a low level of uPAR expressed on cell membrane and in the cytoplasm. Previous study has demonstrated that CD45- mature MM cells tend to show much lower expression of uPAR compared with CD45+ immature MM cells， indicating the level of uPAR is tightly regulated at different stages of cell differentiation.25

Taken together， our study revealed that uPAR level in the bone marrow is associated with the progression of MM. More studies should be conducted to reveal the mechanisms underlying the progression of MM and the role of uPAR.

REFERENCES

1. Maiso P， Huynh D， Moschetta M， et al. Metabolic signature identifies novel targets for drug resistance in multiple myeloma. Cancer Res 2015； 75：2071-82.

2. R?llig C， Knop S， Bornh?user M. Multiple myeloma. Lancet 2015； 385：2197-208.

3. Mehta GR， Suhail F， Haddad RY. Multiple myeloma. Dis Mon 2014； 60：483-8.

4. Qu YJ， Liu TW. The progress of multiple myeloma treatment. J Pract Oncol 2013； 4：351-5.

5. Dass K， Ahmad A， Azmi AS， et al. Evolving role of uPA/uPAR system in human cancers. Cancer Treat Rev 2008； 34：122-36.

6. Jacobsen B， Ploug M. The urokinase receptor and its structural homologue C4.4A in human cancer： expression，prognosis and pharmacological inhibition. Curr Med Chem 2008； 15：2559-73.

7. Duffy MJ， O'Grady P， Devaney D， et al. Urokinaseplasminogen activator， a marker for aggressive breast carcinomas preliminary report. Cancer 1988； 18：531-6.

8. Vassalli JD， Baccino D， Belin D. A cellular binding site for the Mr 55 000 form of the human plasminogen activator，urokinase. J Cell Biol 1985； 100：86-92.

9. Béné MC， Castoldi G， Knapp W， et al. CD87 （urokinasetype plasminogen activator receptor）， function and pathology in hematological disorders： a review. Leukemia 2004； 18：394-400.

10. Luo LH， Xu GB， Lu XG. Detection and clinical significance of plasma urokinase-type lasminogen activator and its soluble receptor in patients with multiple myeloma. Zhejiang Da Xue Xue Bao Yi Xue Ban 2003； 32：529-32.

11. Roodman GD. Role of the bone marrow microenvironment in multiple myeloma. J Bone Miner Res 2002；17：1921-5.

12. Zhang ZN， Shen T. Standard diagnosis and curative effect of hematologic disease. 2nd ed. Beijing： Science Press，1998.

13. Bataille R， Jourdan M， Zhang XG， et al. Serum levels of interleukin 6， a potent myeloma cell growth factor， as a reflect of disease severity in plasma cell dyscrasias. J Clin Invest 1989； 84：2008-11.

14. Smith HW， Marshall CJ. Regulation of cell signalling by uPAR. Nat Rev Mol Cell Biol 2010； 11：23-36.

15. Ferraris GM， Sidenius N. Urokinase plasminogen activator receptor： a functional integrator of extracellular proteolysis， cell adhesion， and signal transduction. Semin Thromb Hemost 2013； 39：347-55.

16. Magnussen S， Hadler-Olsen E， Latysheva N. Tumour microenvironments induce expression of urokinaseplasminogen activator receptor （uPAR） and concomitant activation of gelatinolytic enzymes. PLoS One 2014；9：e105929.

17. Zhuang T， Chelluboina B， Ponnala S， et al. Involvement of nitric oxide synthase in matrix metalloproteinase-9 and/ or urokinase plasminogen activator receptor-mediated glioma cell migration. BMC Cancer 2013； 13：590.

18. Almasi CE， Drivsholm L， Pappot H， et al. The liberated domain I of urokinase plasminogen activator receptor—a new tumour marker in small cell lung cancer. APMIS 2013；121：189-96.

19. Ahn SB， Chan C， Dent OF， et al. Epithelial and stromal cell urokinase plasminogen activator receptor expression differentially correlates with survival in rectal cancer stages B and C patients. PLoS One 2015； 10：e0117786.

20. Li Y， Sun B， Zhao X， et al. Subpopulations of uPAR （+）contribute to vasculogenic mimicry and metastasis in large cell lung cancer. Exp Mol Pathol 2015； 98：136-44.

21. Dohn LH， Illemann M， H?yer-Hansen G， et al. Urokinasetype plasminogen activator receptor （uPAR） expression is associated with T-stage and survival in urothelial carcinoma of the bladder. Urol Oncol 2015； 33：165.e15-24.

22. Magnussen S， Rikardsen OG， Hadler-Olsen E， et al. Urokinase plasminogen activator receptor （uPAR） and plasminogenactivator inhibitor-1 （PAI-1） are potential predictive biomarkers in early stage oral squamous cell carcinomas （OSCC）. PLoS One 2014； 9：e101895.

23. Hou J， Li X， Li C， et al. Plasma membrane gp96 enhances invasion and metastatic potential of liver cancer via regulation of uPAR. Mol Oncol 2015； 9：1312-23.

24. Laurenzana A， Biagioni A， Bianchini F， et al. Inhibition of uPAR-TGFβ crosstalk blocks MSC-dependent EMT in melanoma cells. J Mol Med 2015； 93：783-94.

25. Hjertner O， Qvigstad G， Hjorth-Hansen H， et al. Expression of urokinase plasminogen activator and the urokinase plasminogen activator receptor in myeloma cells. Br J Haematol 2000； 109：815-22.

for publication March 25， 2016.

Tel： 86-572-2023301-2191， Fax： 86-572-2023301-6625， E-mail： hzzxslh@126.com

△Supported by Huzhou Science and Technology Bureau and Huzhou Central Hospital （2014GYB14）.