Precise identification of different stages of a tick，Ixodes granulatus Supino，1897 （Acari:Ixodidae）

Ernieenor Faraliana Che Lah，Salmah Yaakop，Mariana Ahamad，Ernna George，Shukor Md NorAcarology Unit，Infectious Diseases Research Centre，Institute for Medical Research，Jalan Pahang，50588，Kuala Lumpur，MalaysiaCentre for Insect Systematic，School of Environmental and Natural Resource Sciences，F(xiàn)aculty of Sciences and Technology，Universiti Kebangsaan Malaysia，43600，Bangi，Selangor，Malaysia

?

Precise identification of different stages of a tick，Ixodes granulatus Supino，1897 （Acari:Ixodidae）

Ernieenor Faraliana Che Lah1*，Salmah Yaakop2，Mariana Ahamad1，Ernna George1，Shukor Md Nor21Acarology Unit，Infectious Diseases Research Centre，Institute for Medical Research，Jalan Pahang，50588，Kuala Lumpur，Malaysia
2Centre for Insect Systematic，School of Environmental and Natural Resource Sciences，F(xiàn)aculty of Sciences and Technology，Universiti Kebangsaan Malaysia，43600，Bangi，Selangor，Malaysia

ARTICLE INFO Article history: Received 9 Nov 2015 Receivedinrevisedform18Nov，2nd revised form 1 Dec 2015 Accepted 26 Jan 2016 Available online 29 May 2016

Ticks Ixodes granulatus Cytochrome oxidase subunit I Morphology

Original articlehttp://dx.doi.org/10.1016/j.apjtb.2016.05.003

ABSTRACT

Objective:To identify different stages of Ixodes granulatus（I.granulatus）based on morphological characters prior to molecular identification which is significant for confirming and identifying the nymphal stages of I.granulatus.

Methods:A total of 14 individuals of adult，engorged and nymphal ticks collected from three different localities were examined morphologically using taxonomic keys，followed by PCR using cytochrome oxidase subunit I（COI）.Clustering analysis based on COI sequences was carried out by constructing neighbor-joining and maximum parsimony tree to clarify the genetic variation and diversity of local I.granulatus.

Results:Based on external morphological characterizations，nine individuals（64.3%）were successfully identified as I.granulatus，while five individuals were recognized only as Ixodes sp.due to lack of morphological characters visible and development during that stage.Molecular analysis of local I.granulatus using COI gene revealed 93%-94% sequence homology from available sequence in GenBank and was in concordance with the morphological identification.Furthermore，a low intraspecific variation was observed among the species of I.granulatus collected from different localities（0%-3.7%）.

Conclusions:These findings demonstrated for the first time the establishment of COI gene for identifying I.granulatus nymphal tick which is of paramount importance to the control of potential tick-borne infections in Malaysia.Moreover，this study provides evidence that a combination of morphology and molecular data was corroborated as an accurate tool for tick identification.

1.Introduction

Wherever present，ticks pose a threat to human and animals.In tropical countries，theyare considered as the arthropods of medical andveterinaryimportanceonlysecondtomosquitoes［1］.Theyhave theabilitytotransmitvariouspathogenicagentsthatareresponsible fordiseasesandfatalities［2］.Approximately896tickspeciesbelong to three families，namely，Ixodidae，Argasidae and Nuttalliellidae that are described worldwide［3，4］.The genus Ixodes Latreille，1795 is the largest genus in the Ixodidae，comprising 243 species ［5，6］.Ixodes granulatus Supino，1897（I.granulatus）is an exclusively Asian species，ranging from Japan through Southeast Asia and westward to India and China［7］.As a kind of the most widespread species，the distribution of I.granulatus has been reported from various countries including Malaysia［8，9］.Further studies over many years in Peninsular Malaysia have also indicated all active stages of I.granulatus as the most common and abundant species infesting mammals especially rodents ［10，11］.As a vector，I.granulatus transmits a number of pathogens that cause infectious diseases such as human babesiosis，disease caused by Langat virus and rickettsia，and tick typhus［12，13］.

The conventional method to identify ticks is based on microscopicobservationonexternalmorphologicalcharacteristics［14］.Such an approach works well for adult ticks but not for the immature stages（larvae or nymphs）due to the lack of specific taxonomic keys for some genera and not fully developed characteristics［15］.Apanaskevich and Horak in theirstudyondiscriminationofHyalommaanatolicum anatolicum and Hyalomma anatolicum excavatum reported that identification based on morphological characters such as color and size of the scutum of different stages of ticks are veryweak［16］.Inaddition，speciesidentificationby morphological observation can be difficult especially when the physicalcharactersofspecimensaredamagedduring collection，and when the specimens are engorged with blood，or due to similarity in morphologies across different species ［17，18］.To overcome these difficulties，an approach using molecular DNA marker has been examined to evaluate the taxonomic status and identity of ticks.DNA-based methods provide an opportunity to determine intraspecific or intraindividual polymorphism of the sequences［13］，providing much more useful information for the genetic characterization and differentiation of morphologically similar tick species［19］. PCR and online sequences databases such as GenBank are often used in molecular systematics and are now found useful for identifying a variety of medically important species of ticks.

Several DNA markers are routinely used for classification of ticks and studies of different species.Cytochrome oxidase subunit I（COI）gene was actively used as a molecular marker in the identification process of many arthropods due to the higher rates of molecular evolution that allows differentiation between closely allied species［20］.The performance of DNA barcoding in identifying tick species has been evaluated by many researchers［13，21］.Erster et al.tested COI gene to identify Ixodes ricinus（I.ricinus）on beef cattle［22］，while Lv et al. assessed four DNA fragments including COI gene for species identification of Ixodidae［17］.This gene is encoded by mitochondrial genome which is much smaller than nuclear genome and has been considered easier to align because it is a protein coding sequence that has no gaps within alignment ［23］.Proper species identification using molecular markers may offer rapid diagnosis of tick-borne infection as different tick species transmit different pathogens.This is an essential first step for preparedness of the nation to face and manage potential outbreaks of tick-borne infections in future.

I.granulatusticksarecommonlyidentifiedbythepresenceofa single morphological feature which is coxa I with two short spurs wherebytheinternalspurwasslightlylongerthantheexternalspur ［24］.To date，there is no such study on identification of I.granulatus ticks using well defined molecular approach in Malaysia.In order to provide a useful tool for accurate identification of tick，the objectives of this study were therefore to identify different stages of I.granulatus species according to the morphological characters，and verify the species status using molecular markers.Species differentiation and genetic species variation of I.granulatus were determined using clustering analysis based on COI data.

2.Materials and methods

2.1.Ticks sampling

On-host ticks at various developmental and feeding stages （nymph，adult，fully-engorged）were collected from three different localities in Peninsular Malaysia.The study sites were Hulu Langat in Selangor，Bukit Tinggi in Pahang and Gunung Tebu in Terengganu.The habitats chosen were mainly pristine tropical rainforest，secondary forests and shrubs.The localities were chosen based on the records from available previous data of high numbers of tick infestation on small animals［25］.Wire traps baited with bananas and oil palm fruits were used to capture wild rodents and tree shrews in each study site.Caught animals were placed in white cloth bags and brought back to the Institute for Medical Research for further processing.All experimental procedures involving animals were conducted in accordance to InternationalConferenceofHarmonizationGoodClinical Practice Guidelines（Malaysian Research&Ethics Committee）and also approved by the Animal Use Committee of Ministry of Health Malaysia with reference number ACUC/KKM/02（6）2009.The animals were anesthetized with chloroform before screening and the ticks were collected in the laboratory［11］. Each animal was examined in details under 20×magnification and any ticks found around the eyes，ears and any parts of the body were collected.The epidemiology data such as locality and host were recorded.

2.2.Tick morphological identification

A total of 14 on-host ticks were collected using sterile soft forceps or sharpened wooden applicator sticks.The ticks were then kept individually in vials containing 70%ethanol.The collected ticks were examined based on external morphological characteristics under a stereo microscope，model Stemi DV4 Zeiss（Germany）and the samples were preliminarily identified to genera and species levels where using specific illustrated morphological taxonomic keys is possible［24，26］.

2.3.DNA extraction

Considering similar morphological features of these ticks，all different stages of the 14 ticks were subjected to molecular analysis.Prior to DNA extraction，each tick was individually washed three times with sterile distilled water.Extraction of DNA using QIAamp mini kit（Qiagen，Germany）was performed according to manufacturer's protocol.DNA of ticks was extracted by adding 80μL of phosphate buffered saline and 100μL of tissue lysis buffer into the sample.The ticks were then macerated using sterile tips for 5 min before adding 20μL of proteinase K. The samples were incubated at 56°C（6 h）for complete lysis. The following steps were the same as those in the manufacturer's protocols.The DNA was then used for subsequent PCR［27，28］.

2.4.PCR amplification and DNA purification

A pair of universal primers designed by Folmer et al.，namely，LCO1490（5′GGTCAACAAATCATAAAGATATTGG3′）and HCO2198（5′TAAACTTCAGGGTGACCAAAAATCA3′）was used to amplify COI gene using PCR for the ticks species［29］. The PCR reactions were conducted in a final volume of 50μL containing 25μL of 2×Taq PCR Master Mix，2.5μL of 0.5μmol/L of each primer，10μL of nuclease free water and 10μL of DNA template.The PCR was carried out using an EppendorfMasterCyclerPersonalmachine（Eppendorf，Germany）.The amplification program consisted of a total of 35 cycles，denaturation at 95°C for 1 min，annealing at 55°C for 1 min，extension at 72°C for 1.5 min and final extension at72°C for 7 min，with an initial denaturation at 96°C for 1 min. For each PCR reaction，a negative control containing deionized distilled water was included.The PCR products were visualized in 1.5%agarose gels sbtained with ethidium bromide and viewed under an ultraviolet trans-illuminator（wavelength at 254 nm）.The PCR product was excised with a sterile gel cutter and purified using 5 Prime PCR Agarose Gel Extract Mini Kit （Hamburg，Germany）according to the manufacturer's protocols.

2.5.Sequencing and alignment analyses

All PCR products were then directly sent to a local sequencing service company，Medigene Sdn Bhd.in Petaling Jaya，Selangor，Malaysia.The sequencing was bi-directional for all specimens and the primers combination for this step was the same as that used in the PCR amplification.Sequencing results were exported as FASTA sequence files.The COI gene sequences of samples were aligned using ClustalW multiple alignment of BioEdit to determine the similarity of characters between the sequences［30］.In addition，seven Ixodes sequences that were available in GenBank were aligned simultaneously and implemented in dataset of I.granulatus as analysis background and species control（Table 1）.

Table 1DNA sequences obtained from GenBank implemented in the clustering analysis.

2.6.Basic local alignment search tool（BLAST）analysis

The obtained sequences were then compared with those available in the GenBank database using BLAST（http://www. ncbi.nlm.nih.gov/BLAST/）for identification of the species of ticks and detection of sequence contamination.This approach was reported to be simple and robust for rapid comparison of query sequences with database sequences leading to species identification［31］.The approach enabled the similarity of sequences to be measured depending on several criteria such as expected value，maximum identical，query coverage and maximum score［32］.

2.7.Clustering analysis

The clustering analysis for all sequences of ticks was carried out to cluster the I.granulatus species using Phylogenetic Analysis Using Parsimony 4.0b10.For distance analysis，a neighbor-joining tree was generated from a Kimura's twoparameter distance matrix.Maximum parsimony（MP）analysis was performed to determine the most parsimonious tree（s）with a heuristic search of 1000 replications using tree bisection and reconnection option for branch-swapping algorithm.The clustering analyses were set to 1000 replications for both trees.In thisstudy， Argaspersicus（GenBankaccessionNo. FN394341.1）was selected as an outgroup.An examination of the pairwise genetic distance was carried out based on Kimura's two-parameter test in Phylogenetic Analysis Using Parsimony.

3.Results

3.1.Morphological identification

A total of 14 on-host ticks（nymph，adult and fully engorged）weresuccessfullycollectedfromfourspeciesofhosts comprising Leopoldamys sabanus（L.sabanus），Sundamys muelleri（S.muelleri），Rattus tiomanicus and Maxomys surifer （M.surifer）（Table 2）.

Table 2List of locality，host and stages of tick samples used in this study.

Most of the collected ticks were found on the upper and lower abdomens of the rodents，and some on the ears.Nine （64.3%）adult individuals of ticks were successfully identified up to the species level（I.granulatus）using specific taxonomic keys prior to verification using molecular approach for species confirmation and measuring the species variation.Three ticks at nymphal stages and two fully engorged ticks were only identified up to the genus level（Ixodes）based on external morphologicalcharacteristics；thereforethoseindividualswere subjected to molecular identification.

3.1.1.External morphological characteristic

In this study，ticks from the genus Ixodes were identified primarily according to their distinct anal groove embracing the anus anteriorly，forming an arch（Figure 1A）.Additionally，all Ixodes ticks lacked eyes and festoons and possessed an inornate scutum.The body shape was teardrop with a tapering at the mouthparts.On the idiosoma，a pair of spiracular plate or stigmata was identified behind the coxa IV（Figure 1B）with pores served as respiratory organ.For adult Ixodes ticks，mouthparts （gnathosoma）were visible dorsally.Identification of the examined adult Ixodes as I.granulatus was made based on the following combination characters:coxa I with two short spurs whereby the internal spur is slightly longer than the external one （Figure 2），and the gnathosoma is with club-shape palps.

Figure 1.Ventralviewofexternalmorphologicalcharacteristicsofadulttick. A:Ixodes；B:I.granulatus.

Figure 2.Ventral view of coxa I of I.granulatus with two spurs.

3.1.2.Difference in male and female tick

Sexual dimorphism was verified in this species.Male had smaller size than females and the dorsal scutum was well developed，covering almost all dorsal surfaces（Figure 3A）.The dorsal shield or scutum of the female was finely granulated，oval，longer than its wide，covering more than half the length of the dorsal（Figure 3B）.Partial scutum allows the increase in size for body engorgement in female ticks.A porose area with two small depressions consisting of numerous pores was noticed on the dorsal surface of the scutum.This porose area which is present only in female served as olfactory organs which become active during reproduction period.

Figure 3.Dorsal view of the scutum of I.granulatus. A:Male；B:Female.

3.2.Molecular identification and clustering analysis

After alignment and trim，the COI sequences obtained from the ticks in Peninsular Malaysia were approximately 658 bp （including the primers）in length.BLAST results for the ixodid ticks consisted of one genera and one species，namely，Ixodes （I.granulatus）.In general，the percent similarity between queried（unknown）sequences and the closest match in GenBank was between 93%and 94%（Table 3）.Eleven out of 14 sequences（78.5%）showed 94%similarity with the online database while three sequences（GT23-2，GT23-8 and BT04-3）matched to I.granulatus with 93%similarity.A total of 502 bp fragments were obtained from the multiple alignments of COI gene.Sequence analysis indicated that 181（36.1%）variable sites were detected within the COI gene and 86（47.5%）characters were parsimony informative.Additionally，the conserved sites were constituted by 321（63.9%）characters showing that COI gene is a very conserved gene in the mtDNA.Based on clustering analysis，neighbor-joining tree topology（Figure 4）revealed a distinction with 89%bootstrap value for I.granulatus，but a higher bootstrap value of 99%was showed by MP analysis （Figure 5）which easily distinguished I.granulatus from I.ovatus and I.ricinus.Significant grouping of China and Japan I.granulatus ticks sequences in independent monophyletic subclade was obtained with a bootstrap value of more than 98% in both analyses.The results of this study strongly support the discrimination in recognizing the separation of I.granulatus ticks from Malaysia and other countries.

Table 3BLAST results against available sequences in GenBank.

Figure 4.The neighbor-joining tree generated from 22 COI sequences （including 1 outgroup）of I.granulatus identified in the present study and related sequences from the GenBank.The numbers at branches stand for bootstrap values of 1000 replications.

Figure 5.The MP tree generated from 22 COI sequences（including 1 outgroup）of I.granulatus identified in the present study and related sequences from the GenBank.The numbers at branches stand for bootstrap values of 1000 replications.

Pairwise distance analysis of I.granulatus ticks showed that the local species is genetically different from Japan and China species with genetic distance value ranged from 4.8%to 10.5% （Table4）.The highestgeneticdistance（3.7%）between I.granulatus was observed between those from Gunung Tebu（GT23-8）and Hulu Langat（HL02-1）.There was no significant difference of genetic distance between Hulu Langat and Bukit Tinggi tick populations except for HL02-1（2.8%）.Genetic distance analysis of I.granulatus ticks collected from all the three localities indicated a low level of intraspecific value（＜3.7%）.Although a low intraspecific variation was observed among the same species of I.granulatus，all the 14 local ticks appeared in a monophyletic group and formed a sister clade with I.granulatus from Japan and China.However，interspecific distances analyzed by the pairwise comparisons revealed that the local population of I.granulatus ticks genetically was closely related to I.ricinus compared to I.ovatus with level of genetic variation being 7.2%-13.1%and 17.8%-23.6%，respectively.

4.Discussion

4.1.Morphological identification

Morphological characters have been widely used for classifying and identifying diversity in acarology including ticks［33］. The general techniques were direct observation of external phenotype differences between individuals.In the present study，the morphological features observed suggest that ticks collected most probably belonged to the genus Ixodes and species I.granulatus［34］.The presence of this species in Malaysia was also reported from previous investigations［7，35］. Additionally，the most distinct external feature i.e.internal spur longer than external spur on coxa I of adult I.granulatus observed is similar to that described by Kohls［24］.The reliabilityofmorphologicalfeaturesascriteriaforthe identification of adult I.granulatus was showed by several other studies［36，37］.However，there are multiple difficulties associated with accurate identification of immature stages and fully engorged tick.In this study，nymphs and fully engorged ticks were unable to be identified up to species level.The fully engorged ticks were difficult to be distinguished with naked eyes due to their appearance and color［14］.Moreover，when full-engorged they appear dark in color，similar in size and significantly distort some features［38］.Besides，species determination for immature stages such as nymph is limiteddue to unavailable or lack of taxonomic keys except adults and notfullydevelopedmorphologicalcharacteristics［39，40］. Consequently，thesedifficultiesandthereliabilityof morphological features as criteria for the identification of I.granulatus was reinforced in this study by using keys based on molecular genetic marker.

Table 4Genetic distance values of the COI DNA sequences.%.

4.2.Molecular identification

The universal DNA primers，LCO1490 and HCO2198［29］，are frequently used in species identification and phylogenetic studies due to the ability to amplify successfully a 710 bp region of the mitochondrial COI gene from a broad range of metazoan invertebrates［41］.The universal primers for this gene are very robust，enabling recovery of its 5′regions from representatives of most animals［20］.A similar study of genetic variabilityofI.ricinusbasedonanalysisofCOI mitochondrialDNA［42］，concludedthatthisgenewas considered to provide a better means to study differences between species within the same genus as well as confirm morphological identification.As demonstrated in previous studies［19，21，28］，comparison between COI sequences is clear and direct because insertions and deletions（indels）are rare，hence the closely related species can easily be confirmed. Obtained COI gene sequences are the first reported DNA barcodingsequencesofI.granulatustickscollectedin Peninsular Malaysia.Prior to this study，there were only four COI sequences for I.granulatus have been published in GenBank.Therefore，sequences obtained in the present study only revealed 93%-94%sequence homology compensating for this lack of information on genetic data in case of local I.granulatus.Some of the differences were probably caused by intraspecific variation and in some cases，it could be due to poorsequencequality， particularlywhenunassigned nucleotides（Ns）were present in the sequence.Variations in DNA sequences encoding COI among individuals of the same species were also common which explain the polymorphism of this marker［18］.It has been suggested that for molecular identification of tick species，sequencing of the COI gene should be the first method of choices，and analysis of other geneslike12Sor16SrDNAcanbeperformedas complementary analysis［17，43，44］.The results of this study further demonstrated that the success of ticks DNA barcoding relies heavily on the accurate morphological identification to complement and verify molecular data.

4.3.Clustering analysis

Genetic and clustering analyses have been extensively used to identify species and to understand phylogenetic relationships of ticks in the past two decades［45-48］.The appearance of the adult stage of I.granulatus ticks in Southeast Asia provides similar morphological feature which is not visible with naked eyes.Hence，genetic characterizations with regard to the geographical distribution［13］of these species need to be further defined in understanding the nature of ticks for their effective control［18］.Findings of the present study have confirmed the identity of I.granulatus ticks as supported by the genetic clade together with the same species in China and Japan.Regarding to the genetic distance，a low intraspecific variation was observed among I.granulatus ticks collected from different localities（0%-3.7%），but a high interspecific value（7.2%-23.6%）with other species of the same genus was found.Thus，these observations suggest that genetic variation of I.granulatus of Peninsular Malaysia can be determined either by interspecies or intraspecies among tick population by analyzing the mitochondrial COI gene.Notably，the Japan and China ticks were separated from local I.granulatus，providing evidence that geographical differences could be factors that shape the patterns of genetic structure［28］.The results also showed that I.granulatus infested different species of rodents in different localities.Control of these rodents need to be proposed if local I.granulatus ticks were identified to cause any tick-borne infections.

The clustering analysis based on the COI sequences in this study showed a high genetic heterogeneity between local I.granulatus and other species of Ixodes ticks with the formation of distinct genetic assemblages.The clustering patterns of these ticks were according to their geographical origins，not the host species.This finding is agreeable with a previous study which reported that I.granulatus is not host specific because it can infest several hosts including rodents，as well as shrews，squirrels and also men［8，49］.A short-range migration of I.granulatus on host including rodents，could explain the low intraspecific values and the similarity of ticks from some localities in Peninsular Malaysia［7，11，37］.Moreover，tree topologies from differentclusteringanalysesclearlyindicatedthatthe I.granulatus ticks from Hulu Langat and Bukit Tinggi showed close relationship compared to those from Gunung Tebu.Bukit Tinggi which is nearer to Hulu Langat（～50 km）mayprobablyallowfastmobilitypatternofhostand contribute to close genetic relation of the ticks’species［50，51］. Fajs et al.in his study also reported that ticks and rodents from the same or nearby sampling site shared a high level sequence identity compared to ticks from different locations that showed high sequence divergence［52］.

In conclusion，morphological taxonomy of different stages of I.granulatus was supported by the molecular data.Our study produced the first I.granulatus COI barcoding sequences from different localities in Peninsular Malaysia.Based on the clustering analysis of COI gene，both neighbor-joining and MP tree topology showed very clear distinction between I.granulatus，I.ricinus and I.ovatus with a highly supported monophyletic clade.The application of this molecular marker will be useful in studying geographical distribution，intraspecies and interspecies variation of I.granulatus in addition to further strengthening of morphological identification.There is a need to examine more samples of I.granulatus collected from all states of Malaysia in order to access the significance of its genetic variation and diversity in understanding the epidemiology of potential tickborne diseases.

Conflict of interest statement

We declare that we have no conflict of interest.

Acknowledgments

The authors would like to thank the Director-General of Health，Malaysia for his permission to publish this article.We wish to thank staffs of Acarology Unit，Institute for Medical Research for their assistance in the field.The study wassupported by National Institute of Health grant（Code:JPP-IMR 11-010）from the Ministry of Health，Malaysia.

References

［1］Dalgic A，Kandogan T，Kavak H，Ari A，Erkan N，Ozuer MZ. Ticks in the external auditory canal.Hong Kong J Emerg Med 2010；17（2）:190-2.

［2］Cooley K.Identification guide to larval stages of ticks of medical importance in the USA［dissertation］.Statesboro:Georgia Southern University；2015.

［3］Guglielmone AA，Robbins RG，Apanaskevich DA，Petney TN，Estrasa-Pena A，Horak IG，et al.The Argasidae，Ixodidae and Nuttalliellidae（Acari:Ixodida）of the world:a list of valid species names.Zootaxa 2010；2528:1-28.

［4］Schroder B，Reilly BK.A comparison between tick species collected in a controlled and control free area on a game ranch in South Africa.J S Afr Vet Assoc 2013；84（1）:E1-5.

［5］Guzman-Cornejo C，Robbins RG.The genus Ixodes（Acari:Ixodidae）in Mexico:adult identification keys，diagnoses，hosts，and distribution.Rev Mex Biodivers 2010；81:289-98.

［6］Guglielmone AA，Venzal JM，Gonzalez-Acuna D，Nava S，Hinojosa A，Mangold AJ.The phylogenetic position of Ixodes stilesi Neumann，1911（Acari:Ixodidae）:morphological and preliminary molecular evidences from 16 rDNA sequences.Syst Parasitol 2006；65:1-11.

［7］Nadchatram M.The beneficial rain forest ecosystem with environmental effects on zoonoses involving ticks and mites（Acari），a Malaysian perspective and review.Trop Biomed 2008；25（2）: 1-92.

［8］Madinah A，Mariana A，F(xiàn)atimah A，Abdullah MT.A preliminary field survey of ectoparasites of rodents in urban park，Sarawak，Malaysian Borneo.Trop Biomed 2013；30（3）:547-51.

［9］Wilson N.New distributional records of ticks from Southeast Asia and the Pacific（Metastigmata:Argasidae，Ixodidae）.Orient Insects 1970；4:37-46.

［10］Che Lah EF，Yaakop S，Ahamad M，George E，Md Nor S.Molecular phylogeny of a tick，Ixodes granulatus（Acari:Ixodidae）based on cytochrome oxidase subunit I（COI）marker.AIP Conf Proc 2014；1614:719-26.

［11］Madinah A，F(xiàn)atimah A，Mariana A，Abdullah MT.Ectoparasite of small mammals in four localities of wildlife reserves in Peninsular Malaysia.Southeast Asian J Trop Med Public Health 2011；42（4）: 803-13.

［12］Chao LL，Wu WJ，Shih CM.Molecular analysis of Ixodes granulatus，a possible vector tick for Borrelia burgdorferi sensu lato in Taiwan.Exp Appl Acarol 2009；48（4）:329-44.

［13］Chao LL，Wu WJ，Shih CM.Species identification of Ixodes granulatus（Acari:Ixodidae）based on ITS2 sequences.Exp Appl Acarol 2011；54（1）:51-63.

［14］Brahma RK，Dixit V，Sangwan AK，Doley R.Identification and characterization of Rhipicephalus（Boophilus）microplus and Haemaphysalis bispinosa tick（Acari:Ixodidae）of North East India by ITS2 and 16S rDNA and morphological analysis.Exp Appl Acarol 2014；62（2）:253-65.

［15］El-Khammah KM，El-Fiky ZA.Molecular markers of some tick genera in Egypt based on internal transcribed spacer（ITS-2）:1-Ixodidae（Boophilus and Hyalomma）.Arab J Biotechnol 2005；8（1）:61-6.

［16］Apanaskevich DA，Horak IG.The genus Hyalomma Koch，1844.I. Reinstatement of Hyalomma（Euhyalomma）glabrum Delpy，1949 （Acari:Ixodidae）as a valid species with a redescription of the adults，the first description of its immature stages and notes on its biology.Onderstepoort J Vet Res 2006；73:1-12.

［17］Lv J，Wu S，Zhang Y，Chen Y，F(xiàn)eng C，Yuan X，et al.Assessment of four DNA segments（COI，16S rDNA，ITS2，12S rDNA）for species identification of the Ixodida（Acari:Ixodida）.Parasit Vectors 2014；7（1）:93.

［18］Nava S，Venzal JM，Labruna MB，Mastropaolo M，Gonzales EM，Mangold AJ，et al.Hosts，distribution and genetic divergence（16S rDNA）of Amblyomma dubitatum（Acari:Ixodidae）.Exp Appl Acarol 2010；51（4）:335-51.

［19］Zhang RL，Zhang B.Prospects of using DNA barcoding for species identification and evaluation of the accuracy of sequence databases for ticks（Acari:Ixodida）.Ticks Tick Borne Dis 2014；5（3）:352-8.

［20］Young MR，Hebert PDN.Patterns of protein evolution in Cytochrome c Oxidase 1（COI）from the class Arachnida.PLoS One 2015；10（8）:e0135053.

［21］Chitimia L，Lin RQ，Cosoroaba I，Wu XY，Song HQ，Yuan ZG，et al.Genetic characterization of ticks from Southwestern Romania by sequences of mitochondrial cox1 and nad5 genes.Exp Appl Acarol 2010；52（3）:305-11.

［22］Erster O，Roth A，Hadani Y，Shkap V.First detection of Ixodes ricinus on beef cattle in Israel.Vet Parasitol 2013；191（3-4）:394-9.

［23］Zhang AB，F(xiàn)eng J，Ward RD，Wan P，Gao Q，Wu J，et al.A new method for species identification via protein-coding and noncoding DNA barcodes by combining machine learning with bioinformatics methods.PLoS One 2012；7（2）:e30986.

［24］KohlsGM.Malaysianparasites.XVIII.Ticks（Ixodoidea）ofBorneo and Malaya.Stud Inst Med Res Fed Malaya 1957；28:65-94.

［25］Che Lah EF，Yaakop S，Ahamad M，Md Nor S.Molecular identification of blood meal sources of ticks（Acari:Ixodidae）using cytochrome b gene as a genetic marker.Zookeys 2015；（478）:27-43.

［26］Walker AR，Bouattour A，Camicas JL，Estrada-Pena A，Horak IG，Latif AA，et al.Ticks of domestic animals in Africa:a guide to identification of species.Edinburgh:Biosciences Reports；2007，p.221.

［27］Che Lah EF，Ahamad M，Haron MS，Ho TM.Blood meal identification of field collected on-host ticks surrounding two human settlements in Malaysia.Experiment 2013；17（2）:1177-83.

［28］Low VL，Tay ST，Kho KL，Koh FX，Tan TK，Lim YAL，et al. Molecular characterization of the tick Rhipicephalus microplus in Malaysia:new insights into the cryptic diversity and distinct genetic assemblages throughout the world.Parasit Vectors 2015；8:341.

［29］Folmer O，Black M，Hoeh W，Lutz R，Vrijenhoek R.DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.Mol Mar Biol Biotechnol 1994；3（5）:294-9.

［30］Thompson JD，Higgins DG，Gibson TJ.CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment through sequence weighting，position-specific gap penalties and weight matrix choice.Nucleic Acids Res 1994；22（22）:4673-80.

［31］Mitler T，Levy M，Chad F，Karen S.MULTIBLAST:a web application for multiple BLAST searches.Bioinformation 2010；5（5）:224-6.

［32］Fassler J，Cooper P.BLAST glossary.In:National Centre for Biotechnology Information，editor.BLAST Help.NCBI help manual.Bethesda:National Centre for Biotechnology Information （US）；2011.

［33］Fiorini LC，Craveiro AB，Mendes MC，Chiesorin Neto L，Silveira RD.Morphological and molecular identification of ticks infesting Boa constrictor（Squamata，Boidae）in Manaus（Central Brazilian Amazon）.Rev Bras Parasitol Vet 2014；23（4）:539-42.

［34］Cooley RA，Kohls GM.The genus Ixodes in North America.Natl Inst Health Bull 1945；184:1-246.

［35］Mariana A，Mohd KB，Halimaton I，Suhaili ZA，Shahrul-Anuar MS，Nor ZM，et al.Acarine ectoparasites of Panti Forest Reserve in Johor，Malaysia.Asian Pac J Trop Biomed 2011；1（1）: 1-5.

［36］Teng KF，Jiang ZJ.Economic insect fauna of China Fasc 39 Acari: Ixodidae.Beijing:Science Press；1991.

［37］Yamaguti N，Tipton VJ，Keegen HL，Toshhioka S.Ticks of Japan，Korea and the Ryukyu Islands.Provo:Brigham Young University；1971，p.1-226.

［38］Lempereur L，Geysen D，Madder M.Development and validation of a PCR-RFLP test to identify African Rhipicephalus（Boophilus）ticks.Acta Trop 2010；114:55-8.

［39］Gray J，Dantas-Torres F，Estrada-Pena A，Levin M.Systematic and ecology of the brown dog tick，Rhipicephalus sanguineus.Ticks Tick Borne Dis 2013；4（3）:171-80.

［40］Dantas-Torres F，Latrofa MS，Annoscia G，Giannelli A，Parisi A，Otranto D.Morphological and genetic diversity of Rhipicephalus sanguineus sensu lato from the New and Old Worlds.Parasit Vectors 2013；6:213.

［41］Blanco MB，Elfawal MA，Durden LA，Beati L，Xu G，Godfrey LR，et al.Genetic diversity of ixodid ticks parasitizing eastern mouse and dwarf lemurs in Madagascar，with descriptions of the larva，nymph and male of Ixodes lemuris（Acari:Ixodidae）.J Parasitol 2013；99（1）:11-8.

［42］Cakic S，Mojsilovic M，Mihaljica D，Milutinovic M，Petrovic A，Tomanovic S.Molecular characterization of COI gene of Ixodes ricinus（Linnaeus，1758）from Serbia.Arch Biol Sci 2014；66（2）:683-90.

［43］Hornok S，Kontschan J，Estrada-Pena A，F(xiàn)ernandez de Mera IG，Tomanovic S，de la Fuente J.Contributions to the morphology and phylogeny of the newly discovered bat species，Ixodes ariadnae in comparison with I.vespertilionis and I.simplex.Parasit Vectors 2015；8:47.

［44］Norris DE，Klompen JSH，Black WC.Comparison of the mitochondrial 12S and 16S ribosomal DNA genes in resolving phylogenetic relationships among hard ticks（Acari:Ixodidae）.Ann Entomol Soc Am 1999；92（1）:117-29.

［45］LatrofaMS，Dantas-TorresF，AnnosciaG，CantacessiC，Otranto D.Comparative analyses of mitochondrial and nuclear genetic markers for the molecular identification of Rhipicephalus spp.Infect Genet Evol 2013；20:422-7.

［46］Lu X，Lin XD，Wang JB，Qin XC，Tian JH，Guo WP，et al.Molecular survey of hard ticks in endemic areas of tick-borne diseases in China.Ticks Tick Borne Dis 2013；4（4）:288-96.

［47］Veeramani V，Sakthivelkumar S，Tamilarasan K，Janarthanan S. Genetic similarity within isolates of population of the cattle tick，Rhipicephalus microplus based on mitochondrial cytochrome oxidase subunit-I gene sequences.Glob Vet 2014；13（2）:177-83.

［48］Song S，Shao R，Atwell R，Barker S，Vankan D.Phylogenetic and phylogeographic relationships in Ixodes holocyclus and Ixodes cornuatus（Acari:Ixodidae）inferred from COX1 and ITS2 sequences.Int J Parasitol 2011；41（8）:871-80.

［49］PapernaI.ThetickIxodesgranulatusinfestsRattusrattuspopulating a small island offshore of Singapore.Parasite 2006；13:83-4.

［50］Waldenstorm J，Lundkvist A，F(xiàn)alk KI，Garpmo U，Bergstrom S，Lindegren G，et al.Migrating birds and tick-borne encephalitis virus.Emerg Infect Dis 2007；13（8）:1215-8.

［51］Weidmann M，Ruzek D，Krivanec K，Zoller G，Essbauer S，Pfeffer M，et al.Relation of genetic phylogeny and geographical distance of tick-borne encephalitis virus in central Europe.J Gen Virol 2011；92:1906-16.

［52］Fajs L，Durmisi E，Knap N，Strle F，Avsic-Zupanc T.Phylogeographic characterization of tick-borne encephalitis virus from patients，rodents and ticks in Slovenia.PLoS One 2012；7（11）: e48420.

*Corresponding author:Ernieenor Faraliana Che Lah，Acarology Unit，Infectious Diseases Research Centre，Institute for Medical Research，Jalan Pahang，50588，Kuala Lumpur，Malaysia.
Tel:+60 3 26162692
Fax:+60 3 26935928
E-mail:erniee@imr.gov.my
All experimental procedures involving animals were conducted in accordance to International Conference of Harmonization Good Clinical Practice Guidelines（Malaysian Research&Ethics Committee）and also approved by the AnimalUse Committee of Ministry of Health Malaysia with reference number ACUC/KKM/02（6）2009.
Foundation Project:Supported by National Institute of Health grant from the Ministry of Health，Malaysia（Code:JPP-IMR 11-010）.
Peer review under responsibility of Hainan Medical University.The journal implements double-blind peer review practiced by specially invited international editorial board members.