Effect of levocarnitine on TIMP-1, ICAM-1 expression of rats with coronary heart disease and its myocardial protection effect

Shi-Xun Wang, Lei Tan, Jian Wang, Jing-Quan ZhongKey Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, State and Shandong Province Joint Key Laboratory of Translational Cardiovascular Medicine, Qilu Hospital of Shandong University, Jinan, Shandong 500, ChinaDepartment of Cardiology, Weifang People's Hospital, Weifang, Shangdong 604, China

?

Contents lists available at ScienceDirect

Effect of levocarnitine on TIMP-1, ICAM-1 expression of rats with coronary heart disease and its myocardial protection effect

Shi-Xun Wang1,2, Lei Tan2, Jian Wang2, Jing-Quan Zhong1*
1Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, State and Shandong Province Joint Key Laboratory of Translational Cardiovascular Medicine, Qilu Hospital of Shandong University, Jinan, Shandong 250012, China
2Department of Cardiology, Weifang People's Hospital, Weifang, Shangdong 261041, China

ABSTRACT

Objective: To study the eff ect of levocarnitine (L-CN) on tissue inhibitor of metalloproteinase-1 (TIMP-1) and intercellular adhesion molecule-1 (ICAM-1) expression of rats with coronary heart disease and evaluate the protective eff ect of L-CN on myocardial cells. Methods: Highfat diet feeding and intraperitoneal injection of pituitrin was performed on rats in model group and CHD Model of rats was built. Rats with successful model-building were selected and divided into L-CN group and Ctrl group randomly. Rats in L-CN group were given L-CN treatment, with intraperitoneal injection of 200 mg?kg-1?d-1and successive administration for 3 d. Rats in Ctrl group were given equal volumes of normal saline. Blood was collected from carotid artery at diff erent time and expression quantity of creatine kinase-MB (CK-MB) and Troponin 栺 (Tn栺) in serum was detected. Rats in each group were put to death and were separated to obtain the myocardial tissue. Real-time PCR and Western Blotting hybridization were performed to detect the TIMP-1, ICAM-1 expression in myocardial tissue in each group. Statistical analysis was employed to explore the expression changes of TIMP-1 and ICAM-1, and ELISA test was used to analyse the expression changes of myocardial necrosis marker- CK-MB and Tn栺 to learn the eff ect of L-CN and its myocardial protective eff ect. Results: The total cholesterol, triglyceride and blood glucose levels of rats in model group were signifi cantly higher than that in control group, which indicated that due to high-fat diet feeding, blood lipid of rats in model group was obviously higher than that in control group. In myocardial tissue of rats in model group, TIMP-1 level signifi cantly reduced and ICAM-1 level significantly increased (P<0.01). In model group, after L-CN treatment, TIMP-1 level had double increase, while ICAM-1 level had 43% of decrease in L-CN group compared with Ctrl group. After L-CN intervention treatment, CK-MB and Tn栺 content in L-CN group relatively reduced compared with Ctrl group. The diff erence among groups was obvious (P<0.01). Conclusions: L-CN could increase the TIMP-1 expression level and inhibit the ICAM-1 expression level. L-CN has a certain myocardial protective eff ect.

ARTICLE INFO

Article history:

Received in revised form 20 January 2016

Accepted 15 February 2016

Available online 20 March 2016

Levocarnitine

Coronary heart disease

TIMP-1

ICAM-1

1. Introduction

Cardiovascular disease seriously threatens the health of people. At present, about 3.5 million people die of cardiovascular disease in our country each year. In coronary atherosclerotic heart disease [Coronary heart disease (CHD) for short], the lipids in the blood are deposited on the endarterium due to abnormal lipids metabolism, which result in the similar atheromatous lipids deposition on the endarterium. These lipids deposition would cause the arterial stenosis, block the blood flow, lead to heart ischemia and then result in clinical symptoms, like angina pectoris. Due to the higher morbidity rate and mortality rate, CHD has become the most serious cardiovascular disease threatening people’s health[1,2]. CHD is a kind of disease induced by multiple factors. At present, studies show that some primary diseases, like primary hypertension, diabetes, dyslipidemia, are the risk factors inducing CHD. In addition, some habits, like smoking and drinking alcohol, could also induce the abnormal lipids metabolism[3]. Along with in-depth researches on the pathogenesis of CHD, we have achieved great progress formolecular mechanism researches of CHD. Reactive oxygen species accumulation, adhesion molecule increase[4], homocysteine increase in blood and the abnormal expression of blood fibrinogen and clotting factor could result in the occurrence of CHD[5].

At present, clinical treatments for CHD mainly include: blood lipid regulation treatment, anti-platelet aggregation treatment, thrombolytic and anticoagulant drug treatment, angiotensin converting enzyme inhibitors etc[6]. Therapeutic drugs for CHD mainly include: nitrates, statin antilipemic agents, anti-platelet agents, calcium channel blockers etc. Levocarnitine (L-CN) is a kind of small molecule amino acid derivatives and plays an important role in fatty acid oxidation and other major metabolic pathways. L-CN could adjust the balance between sugar and fatty acid oxidation through promoting sugar oxidation, reduce the toxic eff ect of long chain fatty acyl carnitine deposition at ischemic stage on myocardium, optimize the myocardial energy metabolism and then improve the diastolic and systolic function of heart[7-9]. At present, there are no in-depth specifi c mechanism researches on L-CN regulating blood lipid metabolism. In this paper, CHD model of rates is built to discuss the effect of L-CN on Tissue inhibitor of metalloproteinase-1 (TIMP-1) and Intercellular Adhesion Molecule-1 (ICAM-1) expression at mRNA and protein level. Besides, myocardial necrosis marker-creatine kinase-MB (CK-MB), Troponin 栺 (Tn栺) expression changes are analyzed to discuss the effect of L-CN on TIMP-1, ICAM-1 expression of rats with CHD and its myocardial protective eff ect.

2. Materials and methods

2.1. Materials

2.1.1. Experimental animals

A total of 30 specifi c pathogen free (SPF) Wistar rats, with weight (250±50) g, were bought from Beijing Vital River Experimental Animal Technology Co. Ltd. Rats were fed in standard animal cages, with 5 rats per cage. Free eating and drinking were allowed for rats during experimental period. Feeding room had excellent ventilation and natural day and night lighting, with indoor temperature maintained at (18-25)℃.

2.1.2. Reagent and instrument

Cholesterol was bought from Shanghai Biochemical Reagent Co. Ltd. Sodium cholate was bought from JK Chemical Science and Technology Ltd. Propylthiouracil was bought from SIGMA (America). Posterior pituitary injection was bought from Nanjing Xinbai Pharmaceutical Co. Ltd. RNA extraction kit was bought from QIAGEN (German). Inverse transcription kit was bought from Applied Biosystems (America). SYBR Green real-time PCR Master Mix was bought from Applied Biosystems (America). ReadyPrep protein extraction kit was bought from Bio-Rad (America). BCA protein quantitation kit was bought from Vazyme Biotech (China). TIMP-1, ICAM-1 and GAPDH monoclonal antibody was bought from Abcam (UK). HRP-Goat Anti-Mouse IgG was bought from Wuhan Boster Biotechnology Co. Ltd. PVDF membrance (0.22 μm) was bought from Millipore (America). ECL chemiluminiscence dection kit was bought from Millipore (America). CK-MB, Tn栺ELISA dection kit was bought from Wuhan Uscn. AEROSET fully automatic biochemical analyser: Abbott Laboratories. Nucleic acid quantitation analyser: Qubit Fluorometer. Fluorescent quantitation PCR detecting system: Applied Biosystems 7500.

2.2. Methods

2.2.1. Building of CHD model of rats[6-10]

A total of 30 SPF Wistar rats were randomly divided into control group (n=10) and model group (n=20). High-fat diet feeding and intraperitoneal injection of pituitrin were performed on rats in model group and then CHD Model of rats was built. Rats in control group were fed with normal diet. High-fat diet formula consisted of yolk powder (10%), cholesterol (2%), lard oil (10%), propylthiouraci (0.2%), sodium cholate (0.5%), normal diet (77.3%). Each rat in model group was fed with 30 g of high-fat diet everyday, with continuous feeding for 10 weeks. Weight changes of rats were weighed.

Forty-eight hours before the fi nal feeding, rats in model group were injected with pituitrin (30 U/kg), with once every day and continuous injection for 2 d. Before rats were put to death, blood was collected from carotid artery and serum was separated for storing at -20℃. Blood liquid biochemical analyzer was used to detect the total cholesterol (TC), high-density lipoprotein (HDL), low density lipoprotein (LDL) cholesterin, triglyceride (TG) and blood glucose (BG) for confi rming the successful building of model. The animal experiment was performed strictly according to the animal experiment projected that was approved by the animal ethics committee and it was inspected through the daily supervision of welfare ethics.

2.2.2. Real-time PCR detection method

Rats with successful model building were selected and were randomly divided into L-CN group and Ctrl group (n=10). Rats in L-CN group were given L-CN treatment, with intraperitoneal injection of 200 mg?kg-1?d-1and successive administration for 3 d. Rats in Ctrl group were given equal volumes of normal saline. Rats in each group were put to death and myocardial tissues of rats were separated immediately. Precooling PBS (Rnase free) was used to wash the tissues. Tissue samples were ground in liquid nitrogen and total RNA was extracted from cells based on RNA extraction kit descriptions. Then Qubit Fluorometer was used to detect its concentration and purity. According to reverse transcription kitdescriptions, total RNA was inversely transcribed to cDNA and Realtime PCR was performed to detect the related gene. mRNA sequence of target gene was referred in NCBI database and Real-time PCR primers were designed, which were consigned to Beijing Liuhe BGI for gene synthesis. The specific sequence was as followed: TIMP-1 (NM_011593.2): For: CGAGACCACCTTATACCAGCG; R e v: A T G A C T G G G G T G T A G G C G T A, I C A M-1 (NM_010493.2): For: GTGATGCTCAGGTATCCATCCA; Rev: CACAGTTCTCAAAGCACAGCG. Ct values of each gene amplification were detected and Ct values and DNA initial copy numbers showed negative correlation. Double △Ct value method was used to calculate the relative expression levels of target gene: the average value of three parallel repeated experiments was calculated as the Ct value of each sample. △Ct =Ct (Target Gene)-Ct (b-actin),△△Ct= △Ct (sample) -△Ct (contro1). Therefore, the relative expression levels of target gene=2-△△Ct. The relative expression quantity in control group was 20=1[11]. Inverse transcription system (20 μL): 5×SYBR Green Real-time PCR pre-mixed solution (4 μL); iScript reverse transciptase (1 μL); RNA template (1 μg RNA) (1 μg). Primer concentration in the PCR reaction was 300-450 nM, with cDNA template (100 ng) and reaction parameters: predegeneration (95℃, 10 min), degeneration (95℃, 10 s), annealing (Tm-6℃, 20 s), extension (72℃, 33 s), cycle-index (n=40).

2.2.3. Western blotting

Tissue samples were ground in liquid nitrogen and ReadyPrep Protein Extraction Kit was used to extract the tissue proteins. Proper frequency of short impact on the tissue proteins was performed on ice and mixture was pyrolysed at 4℃, with centrifuging for 20 min (13 000 r/min). The supernatant was collected and placed into a new centrifuge tube and then BCA Protein Assay Kit was used to detect the protein concentration. SDS-PAGE electrophoresis was performed on protein samples. After electrophoresis, the gel was soaked in transfer buff er solution for 10 min balancing, with assembly shift ‘Sandwich’, voltage (100 V) and trarsmembran (45-60 min). After trarsmembran was finished, TBST was used to rinse the PVDF membrane for 15 min. Appropriate dilution of primary antibody [diluted by TBST containing 1% (w/v) skim milk] was added for 2 h incubation at room temperature. TBST was used to rinse the membrane for 3 times, with 5-10 min per time. TBST containing 0.05% (w/v) skim milk diluted second antibody (1:10 000, HRP labeled) was used to incubate the membrane; TBST was used to rinse the membrane for 3 times, with 5-10 min per time. Experimental results were exposed and were stored by photo-taking. Quantity one v4.62 software molecular banding grey value was used for statistic analysis, with target protein/b-actin protein semi-quantitative value as the quantitative basis.

2.2.4. ELISA detection method

12,24,36,48,72 h after L-CN intervention treatment and before rats were put to death, blood was collected from carotid artery and serum was separated. ELISA detection kit was used to detect the myocardial necrosis marker-CK-MB, Tn栺 levels in the serum samples. Standard hole, sample hole (to be tested) and blank hole were set up. Standard substances with diff erent concentrations and samples to be tested were put into standard hole for 2 h incubation at 37℃; 100 μL of detection solution (biotinylated primary antibody) was added into each hole and tectorial membrane was used to cover the ELISA plate for 1 h incubation at 37℃; liquid in the hole was poured out and 350 μL of cleaning solution was used for each hole washing, with soaking for 1-2 min and repeated plate-washing for 3 times; 100 μL of HRP-labeled second antibody was added into each hole and tectorial membrane was used to cover the ELISA plate for 30 min incubation at 37℃; 90 μL of TMB substrate solution was added into each hole and tectorial membrane was used to cover the ELISA plate, with keeping out of the sun and coloration for 15-25 min at 37℃; upon the front 3-4 holes of standard hole presented obvious gradient blue color, thereaction was terminated and 50 μL of 2M H2SO4was added. ELIASA was used immediately to detect the OD value of each hole at 450 nm.

2.2.5. Statistical analysis

Statistical software SPSS 17.0 was used for statistical analysis. Results were expressed by mean±SD. Comparison between groups was performed by t-test, with signifi cance testing level: α=0.05.

3. Results

3.1. Identification of CHD model of rats

After the continuous feeding for 10 weeks, weight of rats in control group was (326±12) g and weight of rats in model group was (519±17) g. Compared with control group, weight of rats in model group was signifi cantly increased (P<0.01).

Blood lipid biochemical analyzer was used to detect the TC, HDL, LDL, TG, BG levels for confi rming the successful building of model. Drooping spirits, less activity and dull reaction were observable in model group. Blood liquid was further detected by biochemical analysis and the results were as shown in Table 1. TC, TG, BG levels in model group were signifi cantly higher than that in control group, which indicated that because of high-fatdiet feeding, blood liquid in model group was signifi cantly higher than that in control group and the model building was successful.

Table 1Blood liquid changes of biochemical detection.

3.2. Effect of L-CN on TIMP-1, ICAM-1 expression of rats with CHD

Compared with control group, TIMP-1 level significantly decreased and ICAM-1 level significantly increased (P<0.01) in myocardial tissues of rats in model group. In model group, after L-CN treatment, TIMP-1 level in L-CN group had double increase, while ICAM-1 level had 43% of decrease compared with Ctrl group.

In model group, TIMP-1 level decreased and ICAM-1 level increased, which was in accordance with Real-time PCR experimental results. Quantity one v4.62 software molecular banding grey value was used for statistic analysis, with target protein/b-actin protein semi-quantitative value as the quantitative basis, compared with control group, P<0.05. After L-CN intervention treatment for rats in model group, TIMP-1 level increased and ICAM-1 level decreased in a certain degree, compared with Ctrl group.

3.3. Protective effect of L-CN on myocardial tissues of rats with CHD

Tn I expression levels were at a lower level in control group. 12 h after L-CN intervention treatment in model group, CK-MB and Tn I expression levels had a certain decrease. Along with the continued treatment, CK-MB and Tn I expression levels decreased gradually. 3 d after drug treatment, CK-MB and Tn I expression levels had no obvious difference with control group. CK-MB and Tn I content changes in serum before rats in each group were put to death were shown in Table 2. Myocardial necrosis marker-CK-MB, Tn I expression levels in serum signifi cantly increased in model group (P<0.05). After L-CN intervention treatment in model group, CKMB and Tn I content in L-CN group reduced, compared with Ctrl group. The diff erence among groups was obvious (P<0.01).

Table 2CK-MB, Tn I detection in serum using ELISA test.

4. Discussion

Abnormal lipids metabolism is an important inducing factor resulting in cardiovascular disease. The lipids in the blood are deposited on the endarterium due to abnormal lipids metabolism, which results in the similar atheromatous lipid material deposition on the endarterium. These lipid material depositions would cause the arterial stenosis, block the blood fl ow, lead to heart ischemia and then result in clinical symptoms, like angina pectoris. At present, clinical treatments for CHD mainly include: blood lipid regulation treatment, anti-platelet aggregation treatment, thrombolytic and anticoagulant drug treatment, angiotensin converting enzyme inhibitors etc[6], among which, blood lipid regulation treatment is suitable for all patients with CHD[12].

Carnitine is a kind of native compound and there are three kinds of isomer in nature: L-carnitine, R-carnitine and D-carnitine. Studies showed that only L-CN had physiological and pharmacological eff ects. L-CN is mainly distributed in the cardiac muscle and skeletal muscle. It could bring the long-chain fatty acids into mitochondrial matrix, promote the fatty acid oxidation and decomposition, provide the ATP for cells and export the short-chain fatty acyl, which is generated in mitochondria. L-CN itself is not the nutrient of organism, but a kind of necessary cofactor of fatty acid entering into mitochondria for β-oxidation[13,14]. Researches showed that L-CN played an important role during the process of myocardial cell fatty acid metabolism. At present, L-CN is used in the treatment of CHD clinically. L-CN is used to adjust the lipid metabolism, reduce the myocardial necrocytosis and fi brosis induced by ischemic hypoxemia, repair the damaged myocardial cells and fi nally recover the normal function of heart[15].

Pathogenesis of CHD is very complex. Except for abnormal lipids metabolism, infl ammation involving in the process of atherosclerosis is also generally recognized by scholars. Studies found that infl ammatory reaction ran through the whole process from lipid formation to plaque rupture[16,17]. The reconstruction of extracellular matrix plays an important role during the process of atherosclerosis development. Researches found that matrix metalloproteinases (MMPs) played an important regulating eff ect during the processof extracellular matrix formation[18]. The abnormal MMPs expression or enzymatic activity could result in the epimatrix deposition and tissue inhibitor of matrixmetalloproteinases (TIMPs) could inhibit the MMPs activity. The abnormal MMPs expression promotes the excessive proliferation of smooth muscle cells, which results in various infl ammatory cell infi ltration, causes intravascular stenosis and then promotes the atherosclerotic formation. There is evidence that TIMPs plays an effect of regulating blood lipid metabolism through regulating the MMPs activity[19]. However, there are no in-depth researches on the actionmechanism of TIMPs during the process of CHD development. In this paper, CHD model of rates was built to discuss the effect of L-CN on TIMP-1, ICAM-1 expression and its myocardial protective eff ect, aiming to provide some theoretical basis for CHD clinical treatment.

The building of CHD model of rats: model rats were randomly divided into L-CN group and Ctrl group. Rats in L-CN group were given L-CN treatment, with intraperitonealinjection of 200 mg?kg-1?d-1and successive administration for 3 d. Rats in Ctrl group were given equal volumes of normal saline. After L-CN intervention treatment, Real-time PCR detection was used to analyze the eff ect of L-CN on TIMP-1, ICAM-1 expression. The results showed that in myocardial tissues of rats in model group, TIMP-1 level was signifi cantly reduced and ICAM-1 level was signifi cantly increased (P<0.01). In model group, after L-CN treatment, TIMP-1 level haddouble increase, while ICAM-1 level had 43% of decrease in L-CN group, compared with Ctrl group, which were in accordance with the western blotting hybridization results. After L-CN intervention treatment for rats in model group, TIMP-1 level in myocardial tissues was increased and ICAM-1 level was decreased in a certain degree, compared with Ctrl group, which indicated that L-CN, as a kind of regulatory factor of lipid metabolism, the biological eff ects of which were showed at multiple levels. L-CN could inhibit the MMPs through increasing the TIMP-1 expression. In addition, L-CN could reduce the immune cell (monocyte etc) infiltration, inhibit the infl ammatory process and fi nally slow down the process from lipid formation to plaque rupture.

CK-MB and Tn栺 were the most common biochemical indexes for myocardial damage diagnosis[20]. In order to explore the protective effect of L-CN on myocardial cells, we discussed the protective eff ect of L-CN on myocardial tissues from the perspective of myocardial damage. Serum of rats in model group was separated and ELISA test was used to detect the myocardial necrosis marker-CK-MB, Tn栺 expression changes in serum. The results showed that myocardial necrosis marker-CK-MB, Tn栺 expression levels in serum were significantly increased in model group (P<0.05). After L-CN intervention treatment for rats in model group, CKMB, Tn栺 content were relatively reduced, compared with Ctrl group. Diff erence among groups was signifi cant (P<0.01). Through myocardial damage markers, we could verify that L-CN had a certain repairing and protective effect on myocardial tissues of rats with CHD. As for this protection mechanism, we thought that myocardial cells could obtain the metabolism required L-CN in a normal physiological state. When ischemic hypoxemia occurred, myocardial cell could not obtain adequate ATP. Therefore, exogenous supplement of L-CN could relieve the myocardial damages induced by endogenous L-CN synthesis disturbance.

Conflict of interest statement

We declare that we have no confl ict of interest.

References

[1] Piccolo R, Giustino G, Mehran R, Windecker S. Stable coronary artery disease: revascularisation and invasive strategies. Lancet 2015; 386(9994): 702-713.

[2] Lala A, Desai AS. The role of coronary artery disease in heart failure. Heart Fail Clin 2014; 10(2): 353-365.

[3] Liu HK, Li XF, Zhang SZ, Ren Y, Yong-Xin, Liu YQ, et al. Association of Sst I polymorphism in apolipoprotein C3 gene with hypertriglyceridaemia in coronary atherosclerotic heart disease and type Ⅱ diabetes mellitus in Chinese population. Yi Chuan J 2005; 32(1): 11-18.

[4] Ghattas A, Griffiths HR, Devitt A, Lip GY, Shantsila E. Monocytes in coronary artery disease and atherosclerosis: where are we now? J Am Coll Cardiol 2013; 62(17): 1541-1551.

[5] Geng JF. Risk factors and research progress of coronary heart disease. Med Recapitulate 2011; 17(15): 2310-2311.

[6] Xiao JF. Experimental study on the regulating effect of Xintong Tai granules on endothelial function of rats with coronary heart disease [Thesis]. Hunan: Hunan University of Chinese Medicin: 2015.

[7] Mock CM, Schwetschenau KH. Levocarnitine for valproic-acid-induced hyperammonemic encephalopathy. Am J Health Syst Pharm 2012; 69(1): 35-39.

[8] Zhang MQ, Wu AP, Shen Y, Chen H, Tu JF, Zhai CL. Effects of L-carnitine and bisprolol on endoplasmic reticulum stress-mediated myocardial injury after cardiopulmonary resuscitation in rats. Zhonghua Yi Xue Za Zhi 2015; 95(19): 1475-1478.

[9] Shang RP, Sun ZQ, Li H. Effective dosage of L-carnitine in the secondary prevention of cardiovascular disease: a systematic review and meta-analysis. BMC Cardiovasc Disord 2014; 14: 88.

[10] Klocke R, Tian W, Kuhlmann MT, Nikol S. Surgical animal models of heart failure related to coronary heart disease. Cardiovasc Res 2007; 74(1): 29-38.

[11] Mortarino M, Franceschi A, Mancianti F, Bazzocchi C, Genchi C, Bandi C. Quantitative PCR in the diagnosis of Leishmania. Parassitologia 2004; 46(1-2): 163-167.

[12] Okumura Y, Watanabe I, Nakai T, Ohkubo K, Kofune T, Kofune M, et al. Impact of biomarkers of infl ammation and extracellular matrix turnover on the outcome of atrial fi brillation ablation: importance of matrix metalloproteinase-2 as a predictor of atrial fi brillation recurrence. J Cardiovasc Electrophysiol 2011; 22(9): 987-993.

[13] Calvani M, Reda E, Arrigoni-Martelli E. Regulation by carnitine of myocardial fatty acid and carbohydrate metabolism under normal and pathological conditions. Basic Res Cardiol 2000; 95(2): 75-83.

[14] Xiang DK. Experiments and clinical researches on levocarnitine cardioprotective effects [Thesis]. Wuhan: Huazhong University Of Science And Technology: 2006.

[15] Dinicolantonio JJ, Niazi AK, McCarty MF, Lavie CJ, Liberopoulos E, O’Keefe JH. L-carnitine for the treatment of acute myocardial infarction. Rev Cardiovasc Med 2014; 15(1): 52-62.

[16] Li YJ, Yang Q, Weng XG, Zhu XX. Analysis of inflammatory reaction of atherosclerosis model. Zhongguo Zhong Yao Za Zhi 2007; 32(23): 2500-2504.

[17] Ao SL. Influence of Huxinkang tablet on MMP-9, TIMP-lmRNA expression of rabbits with atherosclerosis [Thesis]. Hunan: Hunan University Of Chinese Medicine: 2015.

[18] Liu H, Pan H, Yang H, Wang J, Zhang K, Li X, et al. LIM mineralization protein-1 suppresses TNF-α induced intervertebral disc degeneration by maintaining nucleus pulposus extracellular matrix production and inhibiting matrix metalloproteinases expression. J Orthop Res 2015; 33(3): 294-303.

[19] Graham CA, Chan RW, Chan DY, Chan CP, Wong LK, Rainer TH. Matrix metalloproteinase 9 mRNA: an early prognostic marker for patients with acute stroke. Clin Biochem 2012; 45(4-5): 352-355.

[20] Kruse JM, Enghard P, Schr?der T, Hasper D, Kühnle Y, J?rres A, et al. Weak diagnostic performance of troponin, creatine kinase and creatine kinase-MB to diagnose or exclude myocardial infarction after successful resuscitation. Int J Cardiol 2014; 173(2): 216-221.

Document heading 10.1016/j.apjtm.2016.01.025

IF: 1.062

Asian Pacific Journal of Tropical Medicine

journal homepage:www.elsevier.com/locate/apjtm

15 December 2015

*

Jing-Quan Zhong,Attending Physician, Professor, M.D., Department of Cardiology, Qilu Hospital of Shandong University, No.107, West Wenhua Rd., Jinan, Shandong 250012, China.

Tel:13791123056

E-mail: gilman_zhong@hotmail.com

Foundation project: It was supported by Natural Science Foundation of China (81270238), Doctoral degree Scientifi c Research Foundation of Ministry of Education (20100131110059) and Shandong Science and Technology Development Plan (2012G0021850).