Identification of a novel pathway involving a GATA transcription factor in yeast and possibly in plant Zn uptake and homeostasis

Matthew J.Milner,Nicole S.Pence,Jiping Liu and Leon V.Kochian＊

1Robert W.Holley Center for Agriculture and Health,USDA-ARS,Cornell University,Ithaca,NY 14853,USA,2Department of Plant Biology,Cornell University,Ithaca,NY 14853,USA.＊Correspondence:lvk1@cornell.edu

INTRODUCTION

Noccaea caerulescens(J&C Presl),formerly known as Thlaspi caerulescens,is a Zn/Cd hyperaccumulating plant species which tolerates very high concentrations of Zn and Cd in the soil or growth solution that are toxic to most plants.Furthermore,both Zn and Cd are accumulated to extremely high levels in the N.caerulescens shoot,with leaf Zn and Cd concentrations reaching 30,000 and 10,000 ug/g,respectively,without any toxicity symptoms(Reeves and Brooks 1983;Chaney 1993;Brown et al.1995a,1995b).The recognition by the plant research community of these interesting heavy metal hyperaccumulating phenotypes has greatly increased interest in N.caerulescens for its possible role in the phytoremediation of Zn-and Cd-contaminated soils(Baker et al.1994;Brown et al.1995a).However,the slow growth and low shoot biomass of this plant species limits its direct utility for phytoremediation(Ebbs et al.1997).Exploiting the genetic potential of this species by transferring its metal hyperaccumulating traits to higher biomass plant species may be an effective approach to generate useful and novel metal accumulator plants(Brown et al.1995a).To accomplish this goal,a better understanding of the molecular and physiological mechanisms responsible for Zn/Cd hyperaccumulation is needed.Since it has been shown that Zn hyperaccumulation in N.caerulescens is related to the elevated expression of a number of Zn responsive genes encoding proteins involved in metal transport,the plant species may also serve as a valuable tool for better understanding the mechanisms underlying plant Zn sensing and homeostasis(Lasat et al.2000;Pence et al.2000).

Heavy metal hyperaccumulation in N.caerulescens is linked to elevated expression of several genes encoding transporters that function in Zn transport both in N.caerulescens and also in related non-accumulators,such as the model plant species,Arabidopsis thaliana.These highly expressed Zn transporters appear to be involved in N.caerulescens in different aspects of Zn homeostasis and include ZNT1,a plasma membranelocalized high affinity root Zn uptake transporter(Pence et al.2000;Milner et al.2012),the vacuolar metal transporter,MTP1(Assun??o et al.2001),and HMA4,which is involved in the loading of Zn and Cd into the xylem for translocation to the shoot(Bernard et al.2004;Hussain et al.2004;Papoyan and Kochian 2004).The genes encoding these three transporters have all been shown to exhibit much higher expression in N.caerulescens relative to non hyperaccumulating plant species(Pence et al.2000;Assun??o et al.2001;Bernard et al.2004;Papoyan and Kochian 2004).Furthermore,this gene hyperexpression phenotype may be a feature of metal hyperaccumulators in general.For example,the Zn/Cd hyperaccumulator,Arabidopsis halleri,also exhibits hyperexpression of a number of different genes involved in Zn and Cd transport/homeostasis(Becher et al.2004;Weber et al.2004;Talke et al.2006).There is a significant body of evidence from the literature suggesting that copy number variation,in particular increased gene copy number,is the major factor that contributes to the hyperexpression of these metal-related genes in A.halleri and N.caerulescens(Talke et al.2006;Hanikenne et al.2008;Ueno et al.2011).However not all metalrelated genes that exhibit elevated expression in these two species exist as multiple copies in their genomes,in particular the aforementioned Zn transporter gene,ZNT1(Assun??o et al.2006;Milner et al.2012).In the Assun??o et al.(2006)and Milner et al.(2012)studies on NcZNT1,it appears that specific cis acting elements also play a role in the hyperexpression of this gene,and these findings set the stage for the research findings presented in the current manuscript.

Much less is known about the molecular basis of plant Zn uptake,translocation and homeostasis compared to yeast model systems such as Saccharomyces cerevisiae that have been well characterized in terms of the molecular basis for Zn transport and homeostasis.In S.cerevisiae,the transcription factor,ZAP1,has been found to control the expression of the high and low affinity zinc transporters,ZRT1 and ZRT2,in response to Zn deficiency(Zhao and Eide 1997).A zap1 loss of function mutant was shown to be unable to activate expression of ZRT1 and ZRT2,limiting yeast Zn uptake and growth under low Zn conditions(Zhao and Eide 1997).In the current study,we screened a Noccaea caerulescens cDNA library to identify plant genes that rescue the restricted growth of zap1Δ yeast cells under low Zn conditions to identify candidate Zn-responsive regulatory proteins from plants.It is interesting to note that an outcome of this research was the generation of new information regarding molecular regulation of Zn transport/homeostasis in both yeast and plants.

Figure 1.NcE2F’s complement zap1Δ yeast mutantExpression of NcE2F1 and NcE2F2 in the Δzap1 yeast mutant restored yeast growth on low Zn SD minimal media to the level of growth exhibited by the parental wild type.SD media was supplemented with a zinc chelate made from 1 mM EDTA and 2 mM ZnSO4(Zn sufficient)or 500 μM ZnSO4(Zn limiting).NcE2F1 and NcE2F2 were expressed behind the constitutive yeast phosphoglycerate kinase promoter in the pFL61 yeast expression vector.

RESULTS

Identification of transcriptional regulators via yeast complementation

A yeast complementation strategy was used to identify N.caerulescens genes capable of regulating the expression of yeast genes encoding micronutrient/heavy metal transporters.This involved the transformation of the yeast mutant,zap1Δ,with a N.caerulescens cDNA library constructed from RNA isolated from both root and shoot tissue in plants grown on both Zn replete and Zn deficient conditions.An estimated four hundred fifty thousand N.caerulescens cDNA’s were screened for complementation of the zap1Δ mutant inability to grow on low Zn media.This complementation screen identified three N.caerulescens genes that conferred the ability of the Δzap1 strain to achieve normal growth on Zn limiting conditions.One of these genes was NcZNT1,which we previously identified as a high affinity Zn uptake transporter localized to the N.caerulescens plasma membrane and highly expressed in roots and shoots(Pence et al.2000;Milner et al.2012).In the case of NcZNT1,when this N.caerulescens Zn transporter is constitutively expressed in the yeast mutant it simply is replacing the function of the yeast ZRT1 and ZRT2 Zn transporters in yeast Zn uptake.

The other two unique cDNA’s that were able to restore the growth of this yeast mutant to levels near those of wild type yeast turned out to be members of the E2F family of transcriptional regulators that have been shown to be involved in cell cycle regulation and synthesis of DNA.We named these two genes NcE2F1 and NcE2F2,based on their sequence homology to AtE2F1 and AtE2F2(Figure S1).The predicted open reading frames for NcE2F1 and NcE2F2 are 444 and 387 amino acids in length and share greater than 85%amino acid identity with AtE2F1 and AtE2F2.Alignment of the NcE2F amino acid sequence with other known plant E2F proteins shows that the NcE2F proteins contain many of the same domains that help to define the E2F family(Figure 1).Both NcE2F1 and NcE2F2 have a putative nuclear localization signal,a leucine zipper domain which helps in dimerization with other proteins,a marked box domain which is important in protein-protein interactions,a DNA binding domain,and a domain for interaction with a retinoblastoma(Rb)protein which has been shown to regulate E2F activity.However,the two N.caerulescens E2F proteins lack the cyclin binding domain found in mammalian E2F’s(Albani et al.2000).NcE2F2 exhibits a high homology to E2F’s across many plant species,including Arabidopsis,rice and tomato(Figure S1).A comparison between the two N.caerulescens E2F proteins with other plant E2F proteins reveals that the NcE2F1 and NcE2F2 proteins only share 40%homology at the amino acid level with each other,which may indicate different roles in the plant.Analysis of the proteins via the PSORT program predicts that both NcE2F1 and NcE2F2 will localize to the nucleus(Horton et al.2007).

Possible role of E2F transcription factors in regulation of Zn transporter gene expression in yeast

Both NcE2F1 and NcE2F2 restored the ability of the yeast zap1Δ mutant to grow under low Zn conditions(Figure 1).To understand how the E2F proteins were able to restore yeast growth on low Zn media,expression of the gene encoding the yeast high affinity Zn uptake transporter,ZRT1,was monitored in yeast grown on low and sufficient Zn.In Figure 2 activation of ZRT1 expression is depicted under both low and replete Zn growth conditions in the zap1Δ strain expressing either NcE2F protein,while no ZRT1 expression was seen in the zap1Δ strains that do not express either E2F protein.By comparison,in wild type yeast ZRT1 expression is activated only in low Zn-grown yeast,as has been shown previously in the literature(Figure 2;Zhao and Eide 1997;Zhao et al.1998).No ZRT1 expression data could be presented for the zap1Δ yeast mutant grown on low Zn conditions since the mutant is unable to grow on this media.Subsequent transformation of the E2Fs into a second yeast mutant,zrt1/zrt2Δ,that does not grow on low Zn because it lacks both high and low affinity yeast Zn uptake transporters,was unable to restore growth(data not shown).These findings suggest that the N.caerulescens E2F1 and E2F2 transcription factors restored yeast growth via activation of expression of the gene encoding the yeast high affinity transporter,ZRT1,which is a member of the ZIP family of transporter and similar in sequence to a number of Arabidopsis and N.caerulescens ZIP transporters,including NcZNT1.

To understand if the complementation of the zap1Δ mutant was a specific attribute of the N.caerulescens E2Fs or if other plant and animal E2Fs also could complement the slow growth phenotype of this yeast mutant on low Zn,we also transformed the zap1Δ yeast mutant with E2Fs from Arabidopsis,rice and humans.At least one E2F member from all three species was able to complement the zap1Δ low Zn phenotype(Figure 3).However,not all E2Fs were able to complement the zap1Δ mutant;both OsE2F3 and HsE2F2 did not complement the slow growth on low Zn phenotype of the zap1Δ mutant.

Figure 2.NcE2F-dependent yeast ZRT1 expression in the zap1Δ yeast mutant backgroundNorthern analysis for expression of the gene encoding the yeast high affinity Zn transporter,ZRT1,in the yeast Δzap1 mutant expressing NcE2F1 or NcE2F2 under the control of the constitutive phosphoglycerate kinase promoter in the pFL61 vector.Yeast was grown on SD media supplemented with 500 μM ZnSO4(Low Zn)or 1mM ZnSO4(Sufficient Zn).The yeast actin gene,ACT1,was used as an internal loading control and showed that there was no significant degradation of mRNA in the Northern blot(data not shown).

Figure 3.Complementation of the restricted growth phenotype under Zn limiting conditions for the zap1Δ yeast mutant via expression of E2F proteins from plants(Arabidopsis and rice)and humans

To begin to understand if the activation of expression of Zn transporter genes by these different E2F proteins was specific for Zn transporters or if heterologous expression of E2F proteins could activate the expression of genes encoding other nutrient transporters,we conducted similar experiments in the yeast Fe regulatory mutant,aft1Δ.The yeast transcription factors AFT1 and AFT2 regulate Fe homeostasis in S.cerevisiae.Under low Fe conditions,they induce the expression of iron regulon genes including the Fe2+uptake transporters,FET3 and FET4,and the plasma membrane ferric reductases,FRE1 and FRE2(Rutherford et al.2005).Under moderately limiting Fe conditions(30 μM BPDS)it appears that NcE2F2 and AtE2F3 weakly complement the lack of growth,while at somewhat more Fe limiting conditions(40 μM BPDS),no growth was seen when any of the N.caerulescens or Arabidopsis E2Fs where expressed in the aft1Δ yeast mutant background.This can be compared to the effect when we expressed AtZIP7 in an Fe uptake defective yeast mutant and were able to restore growth even under highly Fe limiting conditions(80 μM BPDS;Milner et al.2013).Expression of either the N.caerulescens or the Arabidopsis E2Fs in the aft1Δ yeast mutant failed to restore yeast growth on Fe limiting media(Figure 4).

Figure 4.Complementation of the aft1Δ mutant’s restricted growth phenotype on Fe limiting media via expression of N.caerulescens or Arabidopsis thaliana E2FsAft1 is the yeast transcriptional regulator that activates expression of the yeast Fe operon in response to Fe deficiency.None of the five plant E2F genes tested were able to restore growth on mildly Fe limiting media(30 μM BPDS)or severely Fe limiting media(40 μM BPDS)in the aft1Δ mutant.

Do E2Fs control expression of plant Zn transporter genes?

Investigation into whether NcE2F1 and NcE2F2 can regulate the expression of NcZNT1,which encodes the plasma membrane high affinity Zn uptake transporter in N.caerulescens and is also a ZIP family member closely related in sequence to yeast ZRT1 and ZRT2,a genomic fragment starting 1.1 kb upstream of the NcZNT1 start codon and ending at the NcZNT1 stop codon was cloned into the yeast expression vector,pFL61,and the constitutive phosphoglycerate kinase promoter was removed from pFL61.A second pFL61 construct containing 1.1 kb of the NcZNT1 promoter directly upstream of the ORF was also tested.Co-expression of either of the NcE2F’s and either NcZNT1 construct failed to complement the zrt1/zrt2Δ Zn uptake mutant grown on low Zn media(Figure 5),suggesting that the plant E2Fs did not activate the expression of the N.caerulescens ZNT1 gene driven by its own promoter.It should also be noted that no expression of NcZNT1 could be seen in yeast containing a functional ZAP1 gene,when the wild type yeast was transformed with the full NcZNT1 genomic clone.Furthermore,a number of experiments were conducted to see if either of the NcE2Fs bound directly to the NcZNT1 promoter.These included yeast two hybrid as well as gel-shift mobility assays.Under none of the experimental conditions did we find any indication that the NcE2Fs bind directly to the NcZNT1 promoter(data not shown).

Figure 5.Testing the ability of the NcE2Fs to activate the expression of the N.caerulescens high affinity Zn transporter,NcZNT1Expression of NcE2F1 or NcE2F2 and either the NcZNT1 ORF driven by 1.1 kb of the NcZNT1 promoter(ZNT1 ORF)or the NcZNT1 genomic clone harboring the endogenous NcZNT1 promoter(NcZNT1g)did not activate NcZNT1 expression in yeast and restore growth of the yeast double Zn uptake knockout mutant,zrt1/zrt2Δ,on low Zn conditions(SD supplemented with 1 mM EDTA and 500 μM ZnSO4).

Can the E2F proteins replace the ZAP1 protein in yeast?

To understand if the E2F proteins activate expression of ZRT1 directly or if some other protein(s)are involved in the E2F-associated expression of ZRT1,the ZRT1 promoter regions necessary for activation by NcE2F genes were investigated.Two different E2F genes,NcE2F2 and AtE2F2,were expressed in yeast along with one of five serial 5’deletions of the 1 kb region upstream of the ZRT1 start codon driving a LacZ reporter.Mapping of the ZRT1 promoter region required for transcriptional activation of ZRT1 in the zap1Δ mutant expressing either plant E2F protein found that the region of E2F activation was between-445 and-400 upstream of the ZRT1 start codon(Figure 6).This is upstream of the previously identified zinc responsive elements(ZREs)found by Zhao et al.(1998)within the ZRT1 promoter.The promoter region between-445 and-353 by itself was found to be suffciient to mediate activation of ZRT1 expression by the E2F proteins(Figure 6).More detailed mapping of the promoter region between-445 and-353 revealed that the sequence between-400 and-373 is required for activation by the E2F proteins(Figure 7).Three prime deletions of the ZRT1 promoter indicated that there is another region between-500 and-405 capable of activating ZRT1 expression,indicating there are multiple promoter regions outside of the previously identifeid ZRE’s that are involved in the activation of ZRT1 expression in yeast(Figure 7).Sequence analysis of the two regions of the ZRT1 promoter shown here to be involved in E2F-mediated activation(-400 to-377 and-500 to-405)revealed no sequence similarities between these two promoter regions.

Involvement of other transcriptional regulators in E2F-mediated activation of gene expression

The lack of any E2F genes in S.cerevisiae genome indicates that the plant E2Fs must be functionally mimicking a yeast transcription factor that does not share sequence similarities with the E2Fs.We also considered the possibility that the plant E2Fs may be interacting with other yeast proteins in the activation of ZRT1 expression.To search for other yeast genes that might be involved in E2F-mediated activation of ZRT1 expression,yeast microarray-based yeast gene expression analysis was conducted to identify transcriptional regulators more highly expressed in yeast cells expressing NcE2F2 versus yeast expressing the empty pFL61 expression vector.Comparison of the expression profiles of these two genotypes identified 443 yeast genes whose expression was increased(316 genes)or decreased(127 genes)more than two-fold in yeast expressing NcE2F2 compared to yeast expressing the empty vector at a FDR of＜0.05.A full list of the differentially regulated genes is listed in Table S1.The genes in these lists were then analyzed for gene ontology(GO)terms associated with transcriptional regulation(DNA binding and/or transcription factor).Using this approach we were able to significantly narrow down the list to seven yeast genes which included two GATA Zn finger proteins and two sulfur transcriptional activators.Each of these seven yeast genes were cloned into pFL61 and expressed in yeast in order to test their ability to complement the slow growth phenotype of the zap1Δ mutant grown on Zn limiting conditions.Only one of these yeast genes,GAT4,was able to restore growth of the zap1Δ mutant on Zn limiting media(Figure 8).The GAT4 associated growth of the zap1Δ mutant on low Zn media correlated with increased expression of ZRT1 as measured with qRT-PCR(data not shown).

Figure 6.Five prime deletion promoter analysis of the yeast ZRT1 promoter driving a LacZi reporter expressed in the zap1Δ yeast mutant along with NcE2F1,NcE2F2 or AtE2F1A plus sign indicates activation of the LacZi reporter was observed,while a minus sign indicates no expression of the LacZi reporter.Expression of NcE2F1,NcE2F2 or AtE2F1.In the zap1Δ yeast mutant yielded the same results.

Figure 7.Five prime and three prime promoter deletion assays for the yeast ZRT1 promoter,using the β-galactosidase reporter to measure ZRT1 gene activation(A)Serial five prime deletions of the ZRT1 promoter where the number-ATG designates the 5 prime portion of the ZRT1 promoter that is driving the β-galactosidase reporter.(B)Serial three prime deletions of the ZRT1 promoter where the numbers indicate the three prime promoter region that is driving the βgalactosidase reporter.The ZRT1 promoter-reporter constructs were in the yeast zap1Δ yeast mutant,zap1Δ,along with NcE2F1,AtE2F1,or the empty vector,pWV3.Numbers represent the nucleotide position from the start codon.

DISCUSSION

This study began as an effort to identify trans-acting factors in N.caerulescens that play a role in the now well documented hyperexpression of metal transporter genes and metal-related genes that underlie Zn and Cd hyperaccumulation in this species(see,for example,Pence et al.2000;Assun??o et al.2001;Papoyan and Kochian 2004;Ueno et al.2011;Milner et al.2012).A similar association of Zn/Cd hyperaccumulation with elevated expression of metal-related genes has also been observed in the Zn/Cd hyperaccumulator,Arabidopsis halleri(Becher et al.2004;Weber et al.2004;Talke et al.2006;Hanikenne et al.2008).In both cases,one aspect of the hyperexpression involves increased copy number for specific metal transporter genes such as AhHMA4,AhZIP3,AhZIP9,and NcHMA3,(Talke et al.2006;Hanikenne et al.2008;Ueno et al.2011).However,there also are recent published findings suggesting that unique cis elements also are involved in the elevated gene expression in these metal hyperaccumulators,which may both involve Zn-dependent and Zn independent responses(Milner et al.2012).With regards to the role of trans-acting factors in the elevated expression of metal transporters in hyperaccumulators,no transcription factors have been identified in the literature to date.However,in Arabidopsis thaliana,which is a non-accumulating plant species,Assun??o et al.(2010)has identified two basic-region leucinezipper(bZIP)transcription factors,bZIP19 and bZIP23,that are involved in the Zn-dependent regulation of expression of the Zn transporter gene,AtZIP4(which is very similar in sequence to NcZNT1 of this study).They also identified a Zn-deficiency responsive element which is a 10 bp palindromic element that is present as two copies in the AtZIP4 promoter and is the binding site for bZIP19 and bZIP23.An Arabidopsis double bZIP19Δ bZIP23Δ knockout mutant was found to be hypersensitive to low Zn and comparative gene expression profiling between the WT and bZIP19Δ bZIP23Δ knockout lines identified a small suite of Zn responsive genes that included a number of ZIP transporters presumably involved in Zn transport/nutrition.

Because there are no plant genes with sequence similarity to the S.cerevisiae Zn-dependent transcriptional regulator,ZAP1,our expectation for the complementation of the zap1Δ yeast mutant with the N.caerulescens cDNA library was to identify plant transcription factors that shared functional similarity and not sequence similarity with ZAP1.This was what occurred when we found that two N.caerulescens E2Fs transcription factors activated ZRT1 expression.E2Fs are a family of transcriptional regulators that have been shown to be involved in cell cycle regulation and synthesis of DNA in higher eukaryotes,including plants.No E2F genes exist in the yeast genome and there are no reports to date of a role of E2Fs in plant mineral homeostasis.However,in yeast there are examples of proteins involved in cell cycle regulation that also play an additional role in mineral nutrition.For example,regulation of yeast Pi acquisition via the low Pi-induced Pho regulon has been shown to involve the Pho80-Pho85 cyclin–cyclin dependent kinase pair in elevated expression of Pi transporters in response to P deficiency(Ogawa et al.2000).

With regards to E2F-mediated activation of the yeast Zn transporter gene,ZRT1,the findings presented here indicate that this response is not specific to N.caerulescens or even to plant E2Fs.As shown in Figure 3,in addition to N.caerulescens E2F1 and E2F2,certain Arabidopsis,rice and human E2Fs also can activate ZRT1 expression in the zap1Δ yeast mutant.It is possible that this response is specific for regulation of Zn homeostasis as it was not possible to facilitate a similar result with regards to yeast Fe acquisition.That is,it was not possible to complement the lack of growth in low Fe phenotype for the aft1Δ yeast mutant defective in the iron regulon responses to low Fe status(Figure 4).However,because we have only investigated the role of E2Fs in regulation of Zn and Fe nutrition,the specificity of the role of E2Fs in the homeostasis of different metals/minerals awaits more extensive research.

Figure 8.Seven yeast transcription factor genes were identified from a comparative genome-wide microarray study in yeast cells expressing NcE2F2 compared to gene expression in yeast cells expressing the empty vectorThis study identified yeast genes upregulated by yeast NcE2F2 expression.The seven identified transcription factors were tested for their ability to complement the slow growth phenotype exhibited by the zap1Δ yeast mutant under Zn limiting conditions.Note here that expression of yeast GAT4 did complement the ability of the yeast mutant to grow on low Zn media.

At this point,we do not know if E2Fs can activate expression of plant Zn transport genes.Also,currently we can only state that the findings presented here involving E2F activation of ZRT1 expression occurs in yeast.When we co-expressed an NcZNT1 genomic clone in the yeast zap1Δ mutant along with either NcE2F1 or NcE2F2,we saw no activation of NcZNT1 expression;only activation of yeast ZRT1 expression was observed.A key finding from this research was that the NcE2F1 or NcE2F2-mediated activation of ZRT1 expression was indirect,and involved an E2F-mediated increase in the expression of the yeast GATA transcription factor,GAT4.With regards to the possible role of GAT4 in regulation of yeast Zn homeostasis,we identified a putative GATA binding WGATAR motif at-405 to-400 of the ZRT1 promoter(Merika and Orkin 1993)which may be the site GAT4 binds to the ZRT1 promoter influencing ZRT1 expression.This GATA binding site is located near the mapped activation regions of the ZRT1 promoter which we showed are required for activation of ZRT1 expression by the various E2F proteins studied here(Figures 6,7).But the region containing the GATA binding domain is not necessary for activation by the expression of the various E2F proteins as there are regions both upstream and downstream of the GATA site which are able to be activate ZRT1 expression in yeast cells expressing an E2F gene.

There are two relatively recent publications in the literature indicating that GATA transcription factors may play a role in regulating other aspects of mineral nutrition in both plants and yeast.Georis et al.(2009)have shown that four other yeast GATA family members,GAT1,GLN3,DAL80 and GZF3,may play a role in nitrogen sensing and regulation of yeast growth(Georis et al.2009).In that study there was no indication that any of the four GATA proteins enhanced expression of N transporters.

Hong et al.(2013)recently screened an Arabidopsis transcription factor FOX library in transgenic Arabidopsis plants expressing the promoter of the high affinity K uptake transporter,HAK5,driving a luciferase promoter.They identified a number of different transcription factors that enhanced HAK5 transcriptional activation,one of which was AtGATA4.

The findings presented here that identified ZRT1 promoter domains that are different from the previously identified Zn responsive elements involved in ZAP1-mediated regulation of ZRT1 expression from Zhao et al.(1998),suggests there are multiple layers of regulation of expression of ZRT1 expression.As indicated by the mapping of the ZRT1 promoter in Figures 6 and 7,the promoter regions that are needed for E2F and GAT4 associated enhancement of ZRT1 expression are in different locations from the location of the ZRE regions within the ZRT1 promoter.These novel activation sites in the ZRT1 promoter provide some insight into how complex regulation of gene expression associated with Zn homeostasis may be,and presumably involves other currently unidentified proteins.This would be similar to what is being discovered with regards to the role of the Arabidopsis transcription factor,FIT1,and its role in Fedependent regulation of expression of Fe acquisition genes such as IRT1,which encodes the root Fe uptake transporter.The sensing of changes in plant Fe status and the associated regulation of IRT1 expression is not directly activated by FIT1 through binding to the IRT1 promoter.Instead,FIT1 dimerizes with either of two other transcription factors,bHLH38 or bHLH39,to activate expression of genes involved in root Fe acquisition such as IRT1 or FRO1(Yuan et al.2008).Hence,considerably more research is needed to identify the full range of transcriptional regulators involved in both yeast and plant Zn homeostasis,as well as the accessory proteins/modifiers of this regulatory pathway,in order to begin to truly understand how mineral nutrients are sensed by eukaryotic organisms and their acquisition and accumulation regulated at the molecular level.

A final take home message from this research is that evidence has been presented here that the regulation of Zn nutrition in yeast and higher plants is not as highly conserved as we previously believed.The inability to find a plant transcription factor that was able to directly activate the expression of the yeast ZRT1 lends itself to this speculation.Also the lack of activation of the N.caerulescens Zn transporter,ZNT1,via the yeast ZAP1 transcription factor that regulates expression of a yeast Zn transporter that is quite similar to NcZNT1 in both sequence and transport function also suggests that plants and yeast employ quite different trans-and and cis acting elements to regulate closely related Zn transporters.As mentioned earlier in this paper,Assun??o et al.(2010)have implicated the bHLH family of transcription factors in the transcriptional activation of Arabidopsis Zn(ZIP)transporters in a Zn dependent manner.The authors found two ZREs in the promoter of AtZIP4 which were needed to activate ZIP4 expression under Zn deficiency conditions.These ZRE sequences are very different from the ZREs in the promoter of the yeast ZRT1 Zn transporter(Arabidopsis ZRE sequence is RTGTCGACAY and the yeast ZRE sequence is ACCTTNAAGGT),although both sequences are palindromic(Zhao et al.1998;Assun??o et al.2010).Much more study is needed to understand how the range of different Zn transporters in both plants and yeast are regulated and the exact role the Zn transporters themselves play in Zn homoeostasis.Finally,future work dissecting the promoters of other important plant Zn transporter genes such as HMA2/4 and MTP1 is needed since although the expression of these genes is also regulated in a Zn dependent manner,their promoters do not contain the same ZREs as were found in AtZIP4.

MATERIALS AND METHODS

Noccea caerulescens cDNA library construction

Noccea caerulescens ecotype Prayon seedlings were grown for two weeks in 2.2 L pots with 4 plants in each pot in a modified Johnsons nutrient solution containing 1.2 mM KNO3,0.8 mM Ca(NO3)2,0.1 mM NH4H2PO4,0.2 mM MgSO4,50 μM KCl,12.5 μM H3BO3,1 μM MnSO4,0.1 μM NiSO4,0.5 μM CuSO4,2 mM MES(pH 5.5),and 1 μM ZnSO4.After two weeks of growth the nutrient solution was changed and replaced with the same solution(Zn sufficient)or without Zn(Zn deficient)for one more week.Plants were pooled from each 2.2L pot and RNA was extracted from plant roots and shoots using Trizol,according to the manufacturer’s instructions(Invitrogen,Carlsbad,CA,USA).The Ambion polyA purification kit(Invitrogen,Carlsbad,CA,USA)was used to enrich for mRNA’s and the purified RNA was used for cDNA first strand synthesis.A cDNA library was generated using 1 μg of polyA RNA and cDNA clones were generated using the Clontech SMART cDNA Library construction kit(Clontech,Mountain View,CA).Clones were ligated into the bifuncional yeast/Escherichia coli expression plasmid vector,pFL61,using the BstXI/EcoRI sites(Minet et al.1992).

Yeast transformation with N.caerulescens cDNA library

100 mL of-SD-TRPmedia was inoculated with zap1Δ yeast cells(MATα ade6 can1 his3 leu2 trp1 ura3 zap1Δ::TRP1)and grown overnight at 30°C with shaking.30 OD546units of the overnight culture were spun down and used to inoculate 200 ml of 2X Yeast Dextrose Peptone Adenine media(YPDA)grown cells(the resuspenede OD546was around 0.15).Cells were then grown to an OD of 0.6 when measured a 546 nm(this is equivalent to two cell divisions).The 200 mL culture was then divided into four 50 mL Falcon tubes and centrifuged at 700 g for 5 minutes.Each pellet was washed in 30 mL of sterile water and again centrifuged at 700 g for 5 minutes.The supernatant was removed and each pellet was resuspended in 1 mL of a mixture containing 100mM LiOAc and 10 mM of Tris-EDTA buffer(TE)and the cells were transfer to an Eppendorf tube and repelleted.The supernatant was again removed and each pellet was resuspended in 600 μL of LiOAc/TE solution.Four separate tubes were then set up each containing 7 μg of the cDNA library,100 μL single stranded carrier DNA and 600 μL of cells.To this mixture 2.5 mL of 50%PEG in LiOAc/TE solution was added and vortexed for 1 min to transform yeast cells.The cells were then incubated at 30°C for 45 minutes and mixed briefly every 15 minutes.After 45 min,160 μL of DMSO was added to each tube and mixed immediately by shaking.The cell mixture was then incubated at 42°C for 20 minutes.After incubation,the cells were pelleted at 700 g for 5 min and pooled by resuspension in 3 mLs of 2X YPDA and left to recover at 30°C for 90 minutes with shaking.Cells were then pelleted and resuspended in 4.5 mL of 0.9%NaCl for plating.300 μL of cells were spread on and grown for 3–5 days on SD-URA media supplemented with 10 μM Fe-EDTA,and a zinc chelate made from 500 μM ZnSO4and 1mM EDTA in 150 mm plates.The SDURA media contained per liter:6.7 g yeast nitrogen base with ammonium sulfate without amino acids,synthetic complete amino acid supplement minus the appropriate amino acid(s),20 g glucose,0.1 g adenine sulfate,and 15 g bacto-agar.The remaining resuspended cells were plated out at a 1:10,000 dilution in 0.9%NaCl on SD-URA plates to calculate the transformation efficiency.

Yeast transformation with individual genes

Transformation of the various Saccharomyces cerevisiae strains were transformed with the target construct(pFL61 vector or the pFL61 vector with the gene of interest)using the lithium acetate/single-stranded carrier DNA/PEG method.An overnight culture was started from a two day old streak of the zap1Δ strain on the SD-TRP media and grown at 30 °C.1.0 mL of cells was pelleted by centrifugation(13,000g for 30 sec).A mixture of 1 μg of plasmid and 10 μg of salmon sperm DNA(total volume 15 μL)was used to resuspend the cell pellet and then 1 mL of the plate solution consisting of PEG 3,350(50%w/v),100mM lithium acetate,10mM Tris-Cl,pH 7.5,and 1mM EDTA was added to the DNA cell mixture.The mixture was vortexed and incubated at 30°C for one hour.The transformation mix was then centrifuged at 13,000g for 30 sec to pellet the cells.After the supernatant was decanted,the cells were resuspended in 1.0 mL of sterile deionized water.Aliquots of the resuspended cells were plated onto a synthetic complete dropout selection media.Plates were incubated for 3–5 d at 30 °C until transformants were observed.Single colonies were picked from each transformation plate and established on fresh drop out media plates.

RT-PCR expression analysis

cDNA was generated using 500 n g of total RNA using superscript III(Invitrogen,Carlsbad,CA,USA).First strand synthesis was carried out at 42 °C for 1 hr and then 85 °C for 5 min to stop and denature the reverse transcriptase.PCR conditions were:94 °C for 15 sec,an annealing step at 58 °C for 30 sec,and finally an extension step estimating that the time for 1 kb of extension was 1 minute.Amplification products were then cloned into pGEM Easy T vector(Promega,Madison,WI USA)and sequence was verified to ensure correct target amplification.The primers used for amplification were for actin:F GCTCCTCGTGCTGTCTTCCCATCT,R GATGGAGTTGTAAGTAGTTTGGTCA,and for ZRT1:F TCTTCCGTCTTTGTTATTCTTTTCGTG,R TGCACCAATACCTAAACCTTCAAATG.

Activation of ZRT1 expression in cells expressing NcE2F1 and NcE2F2

Northern analysis was performed to assay for the expression of the yeast high affinity Zn transporter gene,ZRT1,in the yeast zap1Δ mutant expressing either NcE2F1 or NcE2F2 under the control of the phosphoglycerate kinase promoter in the pFL61 vector.Yeast were grown on SD media with zinc chelate made with 1 mM EDTA and 2 mM ZnSO4(High Zn),1mM ZnSO4(Sufficient Zn)or 500 μM ZnSO4(Low Zn).Northern analysis was performed on total RNA isolated from high Zn,sufficient Zn and low Zn grown yeast.Ten μg of total RNA was transferred to a nylon membrane(Hybond N+;Amersham Pharmacia)and probed with labeled ZRT1.The membranes were then washed under high stringency twice in a solution containing 0.2X SSC,0.1%SDS at 65°C.

Microarray

Total RNA was isolated from cells containing either NcE2F2 in pFL61 or pFL61 alone grown on SD-URA and harvested at an OD of 0.8.RNA was collect from three different primary transformation colonies.Each individual colony was restreaked once on SD-URA and inoculated into 100 mLs of SD-TRP-URA.Each 100 mL flask was deemed one of three biological replicates.RNA was then sent to Phalanx Biotech Group(Palo Alto,CA)and hybridized on the Yeast Whole Genome Onearray.Data was normalized to the median signal on each array and each treatment was averaged from pooling the three biological replicates.

ZRT1 promoter activation

One kb of DNA sequence upstream of the ZRT1 start codon was cloned into pLacZi using the EcoRI site and transformed into the zap1Δ yeast mutant.NcE2F1,NcE2F2 or AtE2F1 were cloned into the pWV3 plasmid and transformed into the zap1Δ yeast mutant containing one of the promoter deletion fragments and tested for the development of a blue color on SD-Leu,-Ura plates containing 20 μg/mL x-gal.

Quantitative Measurement of ZRT1 promoter activation

The zap1Δ yeast mutant strain expressing an E2F protein and one of the ZRT1 promoter-reporter constructs was grown on SD-TRP-URA to an OD of between 0.8 and 1 and then pelleted via centrifugation.Cells were washed once with Z buffer without β-mercaptoethanol(Z buffer composition:60 mM Na2HPO4,40 mM NaH2PO4,10 mM KCl,1 mM MgSO4)and then pelleted again and resuspended in 150 μL Z buffer+βmercaptoethanol(50 mM).To each tube,50 μL of chloroform and 20 μL of 0.1%SDS was added and the mixture was vortexed for 30 sec.700 μL of ONPG solution(Z buffer+BME+o-Nitrophenyl-β-D-galactoside at 2 mg/mL)was added to each tube.The beta-galactosidase assay reaction was allowed to progress for 20 min and then stopped with 500 μL of 1M NaCO3.The mixture was centrifuges for 10 min at 10K g to remove cell debris and beta-galactosidase enzyme activity was measured at an OD of 420 nm.

E2F activation of NcZNT1 gene expression

The NcZNT1 genomic region including the first 1.1 kb of the promoter was amplified and cloned into pFL61 using the HindIII and NotI sites,by addition of HindIII and NotI sequences to the ends of the NcZNT1 genomic clone.The 1.1 kb NcZNT1 promoter was fused to the open reading frame of NcZNT1 by overlap PCR and cloned into pFL61 using the HindIII and NotI sites.

Albani D,Mariconti L,Ricagno S,Pitto L,Moroni C,Helin K,Cella R(2000)DcE2F,a functional plant E2F-like transcriptional activator from Daucus carota.J Biol Chem 275:19258–19267

Assun??o AGL,Herrero E,Lin YF,Huettel B,Talukdar S,Smaczniak C,Immink RGH,van Eldik M,Fiers M,Schat H,Aarts MGM(2010)Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency.Proc Natl Acad Sci USA 107:10296–10301

Assun??o AGL,Martins PDC,De Folter S,Vooijs R,Schat H,Aarts MGM(2001)Elevated expression of metal transporter genes in three accessions of the metal hyperaccumulator Thlaspi caerulescens.Plant Cell Environ 24:217–226

Assun??o AGL,Pieper B,Vromans J,Lindhout P,Aarts MGM,Schat H(2006)Construction of a genetic linkage map of Thlaspi caerulescens and quantitative trait loci analysis of zinc accumulation.New Phytol 170:21–32

Baker AJM,Reeves RD,Hajar ASM(1994)Heavy metal accumulation and tolerance in British populations of the metallophyte Thlaspi caerulescens J.&C.Presl(Brassicaceae).New Phytol 127:61–68

Becher M,Talke IN,Krall L,Kr?mer U(2004)Cross-species microarray transcript profiling reveals high constitutive expression of metal homeostasis genes in shoots of the zinc hyperaccumulator Arabidopsis halleri.Plant J 37:251–268

Bernard C,Roosens N,Czernic P,Lebrun M,Verbruggen N(2004)A novel CPx-ATPase from the cadmium hyperaccumulator Thlaspi caerulescens.FEBS Lett 569:140–148

Brown SL,Angle JS,Chaney RL,Baker AJM(1995a)Zinc and Cadmium uptake by hyperaccumulator Thlaspi caerulescens grown in nutrient solution.Soil Sci Soc Am J 59:125–133

Brown SL,Chaney RL,Angle JS,Baker AJM(1995b)Zinc and Cadmium uptake by hyperaccumulator Thlaspi caerulescens and metal tolerant silene vulgaris grown on sludge-amended soils.Environ Sci Technol 29:1581–1585

Chaney RL(1993)Zinc phytotoxicity.In:Robson AD,ed.Zinc in Soil and Plants.Kluwer Academic Publishers,Dordrecht,The Netherlands.pp.135–150

Ebbs SD,Lasat MM,Brady DJ,Cornish J,Gordon R,Kochian LV(1997)Phytoextraction of Cadmium and Zinc from a contaminated soil.J Environ Qual 26:1424–1430

Georis I,Feller A,Vierendeels F,Dubois E(2009)The yeast GATA factor Gat1 occupies a central position in nitrogen catabolite repressionsensitive gene activation.Mol Cell Biol 29:3803–3815

Hanikenne M,Talke IN,Haydon MJ,Lanz C,Nolte A,Motte P,Kroymann J,Weigel D,Kr?mer U(2008)Evolution of metal hyperaccumulation required cis-regulatory changes and triplication of HMA4.Nature 453:391–395

Hong JP,Takeshi Y,Kondou Y,Schachtman DP,Matsui M,Shin R(2013)Identification and characterization of transcription factors regulating Arabidopsis HAK5.Plant Cell Physiol 54:1478–1490

Horton P,Park KJ,Obayashi T,Fujita N,Harada H,Adams-Collier CJ,Nakai K(2007)WoLF PSORT:Protein localization predictor.Nucleic Acids Res 35:W585–587

Hussain D,Haydon MJ,Wang Y,Wong E,Sherson SM,Young J,Camakaris J,Harper JF,Cobbett CS(2004)P-type ATPase heavy metal transporters with roles in essential zinc homeostasis in Arabidopsis.Plant Cell 16:1327–1339

Lasat MM,Pence NS,Garvin DF,Ebbs SD,Kochian LV(2000)Molecular physiology of zinc transport in the Zn hyperaccumulator Thlaspi caerulescens.J Exp Bot 51:71–79

Merika M,Orkin SH(1993)DNA-binding specificity of GATA family transcription factors.Mol Cell Biol 13:3999–4010

Milner MJ,Craft E,Yamaji N,Koyama E,Ma JF,Kochian LV(2012)Characterization of the high affinity Zn transporter from Noccaea caerulescens,NcZNT1,and dissection of its promoter for its role in Zn uptake and hyperaccumulation.New Phytol 195:113–123

Milner MJ,Seamon J,Craft E,Kochian LV(2013)Transport properties of members of the ZIP family in plants and their role in Zn and Mn homeostasis.J Exp Bot 64:369–381

Minet M,Dufour ME,Lacroute F(1992)Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs.Plant J 2:417–422

Papoyan A,Kochian LV(2004)Identification of Thlaspi caerulescens genes that may be involved in heavy metal hyperaccumulation and tolerance.Characterization of a novel heavy metal transporting ATPase.Plant Physiol 136:3814–3823

Pence NS,Larsen PB,Ebbs SD,Letham DL,Lasat MM,Garvin DF,Eide D,Kochian LV(2000)The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumulator Thlaspi caerulescens.Proc Natl Acad Sci USA 97:4956–4960

Reeves RD,Brooks RR(1983)European species of Thlaspi L.(Cruciferae)as indicators of nickel and zinc.J Geochem Explor 18:275–283

Rutherford JC,Ojeda L,Balk J,Mühlenhoff U,Lill R,Winge DR(2005)Iron-sulfur protein biogenesis on mitochondrial but not cytosolic aft1/aft2 transcription factors depends on activation of the iron regulon by the yeast.J Biol Chem 280:10135–10140

Talke IN,Hanikenne M,Kr?mer U(2006)Zinc-dependent global transcriptional control,transcriptional deregulation,and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri.Plant Physiol 142:148–167

Ueno D,Milner MJ,Yamaji N,Yokosho K,Koyama E,Clemencia Zambrano M,Kaskie M,Ebbs S,Kochian LV,Ma JF(2011)Elevated expression of TcHMA3 plays a key role in the extreme Cd tolerance in a Cd-hyperaccumulating ecotype of Thlaspi caerulescens.Plant J 66:852–862

Weber M,Harada E,Vess C,Roepenack-Lahaye Ev,Clemens S(2004)Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identifies nicotianamine synthase,a ZIP transporter and other genes as potential metal hyperaccumulation factors.Plant J 37:269–281

Yuan Y,Wu H,Wang N,Li J,Zhao W,Du J,Wang D,Ling HQ(2008)FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake gene expression for iron homeostasis in Arabidopsis.Cell Res 18:385–397

Zhao H,Eide DJ(1997)Zap1p,a metalloregulatory protein involved in zinc-responsive transcriptional regulation in Saccharomyces cerevisiae.Mol Cell Biol 17:5044–5052

Zhao H,Butler E,Rodgers J,Spizzo T,Duesterhoeft S,Eide D(1998)Regulation of zinc homeostasis in yeast by binding of the ZAP1 transcriptional activator to zinc-responsive promoter elements.J Biol Chem 273:28713–28720

SUPPORTING INFORMATION

Additional supporting information may be found in the online version of this article at the publisher’s website:

Figure S1.Alignment of various E2F2’s from N.caerulescens,A.thaliana,O.sativa,and L.esculentum depicting known domains from other previously characterized plant E2F’s,including the nuclear localization signal(NLS),the DNA binding domain,leucine zipper,marked box domain,and retinoblastoma(Rb)binding domain.Alignment was done based on the Clustal W method

Table S1.Yeast gene expression:E2F versus empty vector expressing yeast