Effects of Temperature, Acetate and Nitrate on Methane Generation from Petroleum Hydrocarbons

Liu Chunshuang; Zhao Dongfeng; Zhang Yunbo

(College of Chemical Engineering, China University of Petroleum, Qingdao 266555)

Effects of Temperature, Acetate and Nitrate on Methane Generation from Petroleum Hydrocarbons

Liu Chunshuang; Zhao Dongfeng; Zhang Yunbo

(College of Chemical Engineering, China University of Petroleum, Qingdao 266555)

In this study, the effects of temperature, acetate and nitrate on methane gas production from biodegradation of petroleum hydrocarbons were investigated. The results indicated that methane gas production at 35 ℃ was higher than that obtained at 55 ℃. The acetate addition significant enhanced the methane production at 35 ℃, however, at 55 ℃ the nitrate addition could largely promote the methane production. The microbial community structures were revealed by PCR-DGGE. TheActinobacteria,Clostridia,Clostridiales,Syntrophus,Pseudomonas, andProteobacteria-like bacteria andMethanocellales,Methanosaeta,Methanomicrobiales,Methanolinea,Thermoprotei-like archaea had been enriched at 35 ℃ in the acetate addition test. TheThermoprotei,Proteobacterium,Thermodesulfovibrio-like bacteria andMethanocellales-like archaea had been enriched at 55 ℃ in the nitrate addition test. The results may shed light on the bio-utilization of marginal oil reservoirs for enhancing energy recovery.

petroleum hydrocarbons; nitrate; methane; microbial community

1 Introduction

With the growth of world’s population, the demand for oil increased continuously. On the other hand, the earth’s petroleum supplies are limited, although much non-fossilfuel-based energy is being developed recently. Even optimistic projections suggest that such energy sources will meet less than 10% of world requirements through 2030[1]. In fact, currently the oil recovery techniques can extract only up to 40% of existing oil resources, leaving the remainder stranded in mature oilfields. The phenomenon that methane gas produced from trapped petroleum resources in marginal fields by hydrocarbon-degrading methanogenic consortium provides a new way for prolonging the life of reservoir.

Up to now, methane generation from pure alkanes and crude oil by microbial consortia has been demonstrated in laboratory study of microcosms with near-surface sediments[2-3]and oil reservoirs sediments as the inoculum[4-7]. However, less attention was paid on factors which can promote the methane generation from crude oil, such as temperature, metal ions, and electron acceptors. So, in this study the effects of temperature, acetate and nitrate on methane production during degradation of petroleum hydrocarbons were investigated. Then the microbial community characteristics at different temperature and under acetate or nitrate concentration conditions were explored.

2 Experimental

2.1 Characteristics of production water

The production water used in this study was recovered from a crude-oil producing well in the Shengli oilfield, Shandong province, China. It was collected through sampling valves located at the well head into a 10-L bucket. After the bucket was filled with the produced water, it was sealed immediately to maintain an anoxic condition. Then the bucket was kept at 4 ℃ to be transported back to the laboratory. The temperature of production water was about 65 ℃ and the VFAs in the produced water could not be detected. The other physicochemical characteristics are presented in Table 1.

Table 1 Physicochemical characteristics of the production water

2.2 Enrichment and culturing techniques

Sterilized basal medium (100 mL) containing 1 g of petroleum in 120-mL bottles was inoculated with 2 mL of produced water. The bottles were purged with pure N2for at least 10 min before being crimp-sealed with butyl rubber stoppers. They were kept in the dark at 35 ℃ and 55 ℃, respectively, to allow for the activation and growth of a methanogenic community. The experiment was set up in three groups, i. e.: group A with addition of 0.2 g/L of NaAC·3H2O, group B with addition of 0.2 g/L of NaNO3, and group C with nothing added except the basal medium. The basal medium contained (g/L): NaCl (0.5), MgCl2·6H2O (0.5), CaCl2(0.075), NH4Cl (0.3), KH2PO4(0.3), KCl (0.5) and resazurin (0.000 1). The medium was supplemented with 1.0 mL of trace elements stock solution and 1.0 mL of vitamins stock solution. The trace elements stock solution contained (g/L): CoCl2·6H2O (0.50), CuCl2(0.10), FeCl2·4H2O (7.50), H3BO3(1.00), MnCl2·4H2O (0.50), Na2MoO4·2H2O (0.10), NiCl2·6H2O (0.10) and ZnCl2(0.50). The vitamins stock solution contained (mg/L): vitamin B12(1.00), folic acid (20.0), nicotinic acid (50.0), p-aminobenzoic acid (50.0), pyridoxine-HCl (100), ribo flavin (50.0), thiamine-HCl (50.0) and thioctic acid (50.0). The pH value of basal medium was adjusted to 7.0.

2.3 Analysis method

Methane gas was detected by gas chromatography[8]. The composition of petroleum was analyzed by gas chromatography (GC) according to the test method SY/T 5779-1995. The analysis was carried out using a GC-6890 gas chromatograph (Agilent, USA) equipped with a flame ionization detector (GCFID). A fused-silica capillary column (35 m×0.22 μm) was used with high purity N2(with a purity exceeding 99.99%) serving as the carrier gas. The oven temperature was programmed from 40 ℃ to 320 ℃at a heating rate of 5 ℃/min. The combustion gas wasfed at a rate of 30 mL/min, and the auxiliary combustion gas was air introduced at a rate of 300 mL/min. The injection volume was one μL and the split ratio was 1:50. Data acquisition and handling were computer assisted.

2.4 DNA extraction, PCR, DGGE, and sequence analysis

The DNA of microorganisms in the samples was extracted using a Bacteria DNA mini-kit (Watson Biotechnologies Co., Ltd., Shanghai, China) according to the manufacturer’s instructions. DNA extracts were used as the template for PCR amplification of the 16S rDNA. The 16S rDNA was amplified for bacteria, both with a pair of universal primers (BSF101F-TGGCGGACGGGTGAGAA, and BSF534R-ATTACCGCGGCTGCTGG), and GC-clamp -CGCCCGCCGCGCGCGGCGGGGCGGGGGCACGGGGGG (Invitrogen, Co., Ltd., Shanghai, China) as described by Ren, et al[9]. The 16S rDNA was amplified for archaeal, both with a pair of universal primers (P2-ATTACCGCGGCTGCTGG, and P3-CCTACGGGAGGCAGCAG), and GC-clamp –CGCCCGCCGCGCGCGGCGGGGCGGGGGCACGGGGGG (Invitrogen, Co., Ltd., Shanghai, China) as described by Feng, et al.[10]The reaction mixture (50 μL) contained 10×PCR buffer, 10 mmol of l-1 tri/HCl, 0.2 mmol of l-1 dNTP, 2.5 U of Tap DNA polymerase, 0.5 μmol of l-1 forward primer and 0.5 μmol of l-1 reverse primer, 0.4 mg of l-1 template DNA. The samples were amplified using a 9700 PCR meter (Bio-Rad Laboratories, Hercules, USA) with the following thermal profile: 95 ℃ for 4 min; 35 cycles of 40 s at 95 ℃, 40 s at 55 ℃, and 1 min at 72 ℃ with a 0.1 ℃ decrease in annealing temperature per cycle to 55 ℃. The DGGE test was performed using a DCode universal mutation detection system (Bio-Rad Laboratories, Hercules, USA) with a denaturing gradient ranging from 30% to 60%. The 100% denaturation corresponds to 7 mol/L urea and 40% (v/v) deionized formamide. Electrophoresis was run for 30 min at 20 V and 11 h and then at 60 V and 60 ℃. The obtained gels were silver-stained[11]. Prominent DGGE bands were selected and used for excision. The re-amplified products were purified by a gel recovery purification kit (Watson Biotechnologies Inc., Shanghai, China) and cloned by the pMD19-T plasmid vector system (Takara, Dalian, China) according to the manufacturer’s instructions. The DNA sequences were determined with the chain-termination method on an ABI 3730 DNA sequencer by a commercial service (Sangon, China). All sequences were aligned in the GenBank database using the BLASTN program.

3 Results and Discussions

3.1 Effect of temperature on methane production

After 120-day cultivation of microorganisms amended with crude oil, methane formation was detected. The volume of methane gas under the 55 ℃ incubation condition was higher than that obtained at 35 ℃ (Figure 1). In the period ranging from 120 d to 340 d the methane production rate at 35 ℃ was higher than that achieved at 55 ℃. At last, 7.0 μmol of methane was produced under the reaction condition of 35 ℃, which was by 5.7 μmol higher than that obtained at 55 ℃. This phenomenon may be ascribed to the reason that microorganisms existing in the production water are mesophilic.

The components of saturated hydrocarbons before and after degradation were examined by GC-FID. Visible extent of degradation of petroleum hydrocarbons was observed. According to Figure 2, after degradation, the components of C8and C9hydrocarbons almost disappeared, while then-alkanes ranging from C10—C16hydrocarbons were clearly degraded.

Figure 1 Methane gas production after 340 days of cultivation at 35 ℃ and 55 ℃

3.2 Effect of acetate and nitrate on methane production

The methane gas volumes produced under three conditions (with acetate addition, with nitrate addition, and control test) at 35 ℃ and 55 ℃, respectively, are shown in Figure 3. The methane gas produced through biodegradation of petroleum hydrocarbons under the acetate addition conditions was calculated by the total methane produced minus the gas generated from acetate degradation. The addition of acetate and nitrate significant enhanced the methane production. It was about 24.5 and 31.0 times the result of control test (which was run without any addition) at 35 ℃, respectively. And at 55 ℃ the methane production from petroleum with the addition of acetate and nitrate was about 4.78 and 7.45 times the result of control test, respectively. The overall methane gas volume formed upon nitrate addition was a little higher than the case of acetate addition. This phenomenon may occur since a small amount of acetate added thereby can merely play an important role in promoting the rapid proliferation of microorganisms during the initial stage of the test. However, the addition of nitrate could promote the cracking of petroleum hydrocarbons by microorganisms which is a majorlimiting step in the overall methane production process.

Figure 2 Degradation of saturated hydrocarbons in crude oil

Figure 3 Methane gas production under control tests, nitrate addition and acetate tests at 35 ℃ (a) and 55 ℃ (b)

3.3 Microbial community structures under methane production conditions

Figure 4 Comparison of DGGE profiles based on bacterial 16S rRNA genes of enrichment culture

Figure 5 Comparison of DGGE profiles based on archaeal 16S rRNA genes of enrichment culture

Based on DGGE bands of samples from enrichment cultures after 360 days of incubation, the microbial community structures showed a significant change after enrichment (Figure 4 and Figure 5). A part of dominant bands in Figure 4 and Figure 5 was cut out for DNA sequencing analysis. The sequences with similarity ＞ 97% were considered as the same operational taxonomic unit (OTU). A total of 10 OTUs were obtained for Figure 4 (Table 3) and a total of 8 OTUs were obtained for Figure 5 (Table 4). The bacterial communities after enrichment in the control test (with nothing added) and in the case with acetate addition were similar to those obtained from oil reservoir production water. Bands 1 correspond toClostridiasp., one of members of which was detected in anaerobic enrichment cultures from a non-water-flooded low temperature oil reservoir production water[12]. Band 2 corresponded toFlexistipessp., several strains of which havebeen detected in anaerobic iron-reducing enrichment cultures from an oil reservoir production water amended with crude oil[13]as well as in the thermophilic enrichment cultures derived from oilfield production fluids with the ability to convert oil alkanes to methane[14]. Band 3 corresponded toActinobacteriasp., several strains of which have been isolated and proved as efficient hydrocarbon degraders[15]. Band 4 corresponded toClostridialessp. Band 5 corresponded toPseudomonassp. and many species affiliated to this genus were capable of degrading alkanes[16]. Band 6 and Band 10 wereSyntrophusspp. and many species belonging to this genus had been directly implicated as alkane degraders in methanogenic hexadecane-degrading cultures obtained from ditch mud[17]as well as in methanogenic oil alkane-degrading cultures derived from estuarine sediments[18]. Band 7 revealedActinomycetesp., and Band 8 revealedProteobacteriasp., while Band 9 revealedProteobacteriumsp. Many species affiliated to three genera appeared in methanogenic oil alkane-degrading cultures[19]. Bands 11 and 12 corresponded toAzoarcusspp., members of which have been detected in the thermophilic enrichment derived from oilfield production fluids with the ability to convert oil alkanes to methane.

The archaeal communities in the control test (with nothing added), in the acetate addition case and in the nitrate addition case were similar to those obtained from oil reservoir production water. Band 1 corresponded to unculturedMethanosaetasp., the member of which was detected in production water from an Alaskan mesothermic petroleum reservoir[20]. Band 2 corresponded toMethanocellalessp., and shared 99% similrity withMethanocellasp. HZ254 (Accession number: JN048683) isolated from a rice field. Band 3 also corresponded toMethanocellalessp., and, however, it shared 99% similrity withMethanocella palu-dicolaSANAE (Accession number: AB196288). Band 4 was related to an uncultured archaeon clone CLONG35 (Accession number: DQ478739) found at deep South African gold mines[21]. Band 5 was related toMethanomicrobialessp., members of which were detected in methane production enrichment under sulfate-reduction condition and hydrogenotrophic methanogens[22]. Band 6 corresponded toMethanolineasp., members of which were proved to produce methane utilizing hydrogen[23]. Band 7 corresponded toThermoproteisp., members of which were detected in oil sands tailings pond[24]. Band 8 was related to an uncultured archaeon clone EV818SWSAP109 (Accession number: DQ337101).

Table 3 Retrieval of OUTs by BLAST and sequence match for the bands in Figure 4

Table 4 Retrieval of OUTs by BLAST and sequence match for the bands in Figu

At 35 ℃ the methane production in the acetate addition test was slightly higher than other conditions. Upon comparing the bacterial communities in acetate addition test vs. other conditions, the bands 2, 7, 9, 10 and 12 disappeared and the bands 1, 3, 4, 5, 6, 8 and 11 remained in the acetate addition test. Upon comparing the archaeal communities in acetate addition test vs. other conditions, the bands 1 and 2 disappeared and the bands 3, 4, 5, 6, 7 and 8 remained in the acetate addition test. This result suggests thatActinobacteria,Clostridia,Clostridiales,Syntrophus,Pseudomonas, andProteobacteria-like bacteria andMethanocellales,Methanosaeta,Methanomicrobiales,Methanolinea,Thermoprotei-like archaea had been enriched in the acetate addition test and could maintain higher methane gas production capability.

At 55 ℃ the methane production in the nitrate addition test was slightly higher in comparison with other conditions. Upon comparing the bacterial communities in the nitrate addition test vs. other conditions, the bands 1, 2, 3, 4, 5, 6, 8, 10 and 11 disappeared and the bands 7, 9 and 12 remained in the nitrate addition test. Upon comparing the archaeal communities in the acetate addition test vs. other conditions, the bands 1, 2, 3, 5 and 6 disappeared and the bands 4, 7 and 8 remained in the nitrate addition test. This suggests that the most knownThermoprotei,ProteobacteriumandThermodesulfovibrio-like bacteria andMethanocellales-like archaea and two uncultured archaea strains had been enriched in the nitrate addition test and could maintain higher methane gas production capability.

Figure 6 Presumptive methanogenic degradation of oil alkanes

Overall, the methanogenic route of petroleum hydrocarbons in this study evinced by the microbial communities is shown in Figure 6[2]. The anaerobic decomposition of the complex organic matter to methane requires the concerted effort of metabolically different types of mi-croorganisms including fermentative, syntrophic and methanogenic communities of bacteria. Hydrocarbons would have been biodegraded to acetate (and probably formate and hydrogen) coupled with syntrophic acetate oxidation to H2and CO2followed by methanogenisis from CO2reduction. At 55 ℃ the microbial diversity was significant lower than that of 35 ℃ which might result in the low methane gas production. Under the acetate addition conditions, the small amounts of acetate added may play an important role in promoting the rapid proliferation of microorganisms during the initial stage of the test, which can result in higher methane gas production as compared to the control test. However, under nitrate addition conditions, although the microbial diversities were not abundant, the nitrate reduction bacteria (Bands 11 and 12) enriched thereby, which may promote the cracking of petroleum hydrocarbons by microorganisms, might lead to a major limiting step in the overall methane production process. This may result in methane production to be a little higher than the other conditions in this study.

4 Conclusions

The methane gas produced from the biodegradation of petroleum hydrocarbons was affected by the cultivation temperature, and the addition of nitrate and acetate species. In this study, methane gas production at 35 ℃was 1.22 times higher than that of 55 ℃. The addition of acetate and nitrate significantly enhanced the methane production, which was 24.5 and 31.0 times the value obtained by the control test at 35 ℃ and 4.78 and 7.45 times the value obtained by the control test at 55 ℃. TheActinobacteria,Clostridia,Clostridiales,Syntrophus,Pseudomonas, andProteobacteria-like bacteria andMethanocellales,Methanosaeta,Methanomicrobiales,Methanolinea,Thermoprotei-like archaea had been enriched at 35 ℃in the acetate addition test. The most known crude oildegraders likeThermoprotei,ProteobacteriumandThermodesulfovibrio-like bacteria andMethanocellales-like archaea had been enriched at 55 ℃ in the nitrate addition test. The results may shed light on the bio-utilization of marginal oil reservoirs for enhanced energy recovery.

Acknowledgements:The research work was financially supported by the National Natural Science Foundation of China (No. 21307160), the Natural Science Foundation of Shandong Province (No. ZR2013EEQ030), the Fundamental Research Funds for the Central Universities (No. 24720142053A) and the Research & Technology Development Project of China National Petroleum Corporation (No. 2008D-4704-2).

[1] Energy Information Administration. Annual Energy Outlook[R]. DOE/EIA-0383. U.S. Department of Energy, Washington, 2007

[2] Mbadinga S M, Wang L Y, Zhou Lei, et al. Microbial communities involved in anaerobic degradation of alkanes[J]. International Biodeterioration and Biodegradation, 2011, 65(1): 1-13

[3] Li Wei, Wang L Y, Duan R Y, et al. Microbial community characteristics of petroleum reservoir production water amended withn-alkanes and incubated under nitrate-, sulfatereducing and methanogenic conditions [J]. International Biodeterioration and Biodegradation, 2012, 69: 87-96

[4] Gray N D, Sherry A, Grant R J, et al. The quantitative significance of Syntrophaceae and syntrophic partnerships in methanogenic degradation of crude oil alkanes [J]. Environmental Microbiology, 2011, 13(11): 2957-2975

[5] Mbadinga S, Li K P, Zhou L, et al. Analysis of alkane-dependent methanogenic community derived from production water of a high-temperature petroleum reservoir[J]. Applied Microbiology and Biotechnology, 2012, 96(2): 531-542

[6] Zhou L, Li K P, Mbadinga S, et al. Analyses ofn-alkanes degrading community dynamics of a high-temperature methanogenic consortium enriched from production water of a petroleum reservoir by a combination of molecular techniques[J]. Ecotoxicology, 2012, 21(6): 1680-1691

[7] Gu Guizhou, Li Zheng, Zhao Dongfeng, et al. Isolation and characterization of a thermophilic oil-degrading bacterial consortium[J]. China Petroleum Processing and Petrochemical Technology, 2013, 15(2): 82-90

[8] Wang L Y, Gao C X, Mbadinga S M, et al. Characterization of an alkane-degrading methanogenic enrichment culture from production water of an oil reservoir after 274 days of incubation[J]. International Biodeterioration and Biodegradation, 2011, 65(3): 444-450

[9] Ren N, Xing D, Rittman B E, et al. Microbial community structure of ethanol type fermentation in bio-hydrogen production[J]. Environmental Microbiology, 2007, 9(5): 1112-1125

[10] Feng Y X. The identification of fermentative bacteria from petroleum reservoirs and anaerobic metabolic mechanism of crude oil hydrocarbon [D]. Beijing: Chinese Academy of Agricultural Sciences, 2009 (in Chinese)

[11] Watanabe K, Kodama Y, Harayama S. Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting [J]. Journal of Microbiological Methods, 2001, 44(3): 253-262

[12] Grabowski A, Nercessia O, Fayolle F, et al. Microbial diversity in production waters of a low-temperature biodegraded oil reservoir[J]. FEMS Microbiology Ecology, 2005b, 54: 427-443

[13] Lysnes K, B?dtker G, Torsvik T, et al. Microbial response to reinjection of produced water in an oil reservoir[J]. Applied Microbiology and Biotechnology, 2009, 83(6): 1143-1157

[14] Dahle H, Garshol F, Madsen M, et al. Microbial community structure analysis of produced water from a high-temperature North Sea oilfield[J]. Antonie van Leeuwenhoek, 2008, 93(1/2): 37-49

[15] Orphan V J, Taylor L T, Hafenbradl D, et al. Culturedependent and culture-independent characterization of microbial assemblages associated with high-temperature petroleum reservoirs[J]. Applied and Environmental Microbiology, 2000, 66(2): 700-711

[16] Lai S G. Study on biological treatment test of sewage in the condensed oil [J]. Petrochemical Industry Technology, 2003, 10(2): 35-37 (in Chinese)

[17] Zengler K, Richnow H H, Rossello-Mora R, et al. Methane formation from long-chain alkanes by anaerobic microorganisms[J]. Nature, 1999, 401(6750): 266-269

[18] Jones D M, Head I M, Gray N D, et al. Crude-oil biodegradation via methanogenesis in subsurface petroleum reservoirs[J]. Nature, 2008, 451(7175): 176-180

[19] Siddique T, Penner T, Semple K, et al. Anaerobic biodegradation of longer-chainn-alkanes coupled to methane production in oil sands tailings[J]. Environmental Science & Technology, 2011, 45(13): 5892-5899

[20] Gieg L M, Davidova I A, Duncan K E, et al. Methanogenesis, sulfate reduction and crude oil biodegradation in hot Alaskan oilfields[J]. Environmental Microbiology, 2010, 12(11): 3074-3086

[21] Takai K, Moser D P, De Flaun M, et al. Archaeal diversity in waters from deep South African gold mines[J]. Applied and Environmental Microbiology, 2001, 67(12): 5750-5760

[22] Sakai S, Imachi H, Sekiguchi Y, et al. Cultivation of methanogens under low-hydrogen conditions by using the coculture method[J]. Applied and Environmental Microbiology, 2009, 75(14): 4892-4896

[23] Shestakova N M, Ivoilov V S, Tourova T P, et al. Which microbial communities are present? Application of clone libraries: Syntrophic acetate degradation to methane in a high temperature petroleum reservoir by culture-based and 16S rRNA genes characterisation[M]//Whitby C, Skovhus T L. Applied Microbiology and Molecular Biology in Oilfield Systems. Netherlands: Springer, 2011: 45-53

[24] Penner T J, Foght J M. Mature fine tailings from oil sands processing harbor diverse methanogenic communities[J]. Canadian Journal of Microbiology, 2010, 56(6): 459-470

Received date: 2014-05-07; Accepted date: 2014-08-10.

Prof. Zhao Dongfeng, Telephone: +86-532-86981576; E-mail: zhaodf@vip.sina.com.