Expression of HSP72 in Mouse Preimplantation Embryos with Heat Shock

Suo Jia-jia, Cao Rong-feng, Cui Xiao-ni, Jiang Zhong-ling, Cong Xia, Cui Kai, and Tian Wen-ru

College of Animal Science and Veterinary Medicine, Qingdao Agricultural University, Qingdao 266109, Shandong, China

Expression of HSP72 in Mouse Preimplantation Embryos with Heat Shock

Suo Jia-jia, Cao Rong-feng, Cui Xiao-ni, Jiang Zhong-ling, Cong Xia, Cui Kai, and Tian Wen-ru*

College of Animal Science and Veterinary Medicine, Qingdao Agricultural University, Qingdao 266109, Shandong, China

The objective of the paper was to detect HSP72 expression and HSP72 gene sequence in heat shocked mouse preimplantation embryos and the effects of different thermo conditions on hatching rates of embryos. The mouse blastocysts cultured in vitro were heat treated at 40℃ and 38℃ for 1 h, 2 h and 3 h and then recovered at 37℃ for 3 h, 2 h and 1 h, respectively, to detect their HSP72 gene expression by using RT-PCR after the total RNA extraction. The hatching rate of the blastocysts for different treated groups was recorded and the expression of HSP72 in the blastocysts was determined by Western blot. The results showed that all the groups of blastocysts, including the control, had the expression of HSP72 gene. The expression of HSP72 protein had the highest level in the embryos stressed at 38℃ for 2 h, and it was significantly higher than that in the control group. The expression of HSP72 in the groups of blastocysts treated at 40℃ was not significantly different from that in the control group. The embryos with induction of mild heat shock at 38℃ for 2 h, then subjected to heat shock at 40℃ for 2 h, had a significant higher (P＜0.05) hatching rate of 54.74% compared to 47.85% in the embryos treated directly at 40℃ for 2 h. The above results indicated that the mouse blastocysts were sensitive to heat shock and a mild heat shock induced HSP72 gene expression. Induction of HSP72 expression with mild heat shock helped embryos to tolerate more severe heat shocks.

mouse, heat shock protein 72, heat shock, blastocyst

Introduction

Environmental high temperature, or maternal hyperthermia, leads to an increased loss of early stage embryos in mice (Ozawa et al., 2004; Matsuzuka et al., 2005) and bovine (Ewards et al., 2001), while embryonic development can be disrupted by exposure to high temperature in vitro (Rivera et al., 2001; Tian et al., 2004). However, nowndays the mechanism by which heat shock affects early embryonic development are not understood. The fact is that some embryos survive after elevation of temperature cultured both in vivo and in vitro. The above results from literatures have implicated that some embryos have somehow an active responses to the heat stress in time which enabled them to survive from the effects of the stress.

Evidence implicates that HSP72 is expressed in many cells cultured in vitro (Neuer et al., 1999), as well as mice (Zhang et al., 2007) and bovine (Dastoo et al., 2000) embryos in their early developing stage, which protects cells or embryos from heat shock and increases their tolerance to elevated temperature. However, HSP72 belongs to HSP70 family and HSP70 family includes inducible HSP70 known as HSP72 (Tavaria et al., 1996; Morimoto et al., 1997;Gupta et al., 2010) and constitutive HSP70 known as HSP73 (Hartl et al., 2002). The rapid change of HSP70 may be caused by changes in genetic transcription (Shyu et al., 2000). If the embryo, somehow, gains anti-heat shock ability, it reduces the death rate of embryos under the effect of heat shock and the death rate increases, while HSP70 expression is blocked. Although HSP72 and HSP73 are spontaneously expressed after zygote genome is activated in preimplantation mouse embryos, the high expression of HSP72 is 8-cells or blastocyst stage of its development (Ozawa et al., 2004). The function of HSP72 may due to its inhibition of cell apoptosis and/or repair of proteins damaged by heat shock. In the perspective of biochemical, the thermotolerance of embryos generated from heat shock is a kind of thermal protection mechanism (Ozawa et al., 2004; Zhong et al., 2011). The evidence also shows that the synthesis of most proteins will be terminated under heat shock in mammalian cells (Neuer et al., 1999) while HSP72 starts to express. HSP72 has strong cytoprotective effects and functions as a molecular chaperone in protein folding, transport and degradation (Samali et al., 1998; Garrido et al., 2003). The abundant cytoplasmic and nuclear protein hsc (heat shock cognate) 70 assisted in this task is the highly inducible HSP70, whose synthesis is controlled by the level of nonnative protein substrates.

The objective of the paper was to study the conditions for inducing embryonic HSP72 expression and its effects on the anti-heat shock ability of the mouse blastocysts. We hope that the results of the experiment will provide a reference for further study increasing the heat resistance in preimplantation embryos.

Materials and Methods

Experimental animals and reagents

Nine-week sexual-mature KM mice were purchased from Labanimal Center of Shandong University, and superovulation was performed a week after purchasement for adaptation feeding. The female mice were given hCG (10 IU) 48 h after priming with PMSG (10 IU) to induce super ovulation. The mice were then placed in individual cages with male mice for mating. Those with vaginal plug appeared on the next morning examination were considered to be mated. Trizol Reagent and Ultra PureTM L.M.P Agarose were purchased from Invitrogen, and the reagents for culture media were all from Sigma, AMV, rTaq DNA polymerase, DL2000 Marker, RNasin, and pMD18-T were from TaKaRa. DEPC was from AMERCO and DH5α was preserved by our laboratory. The antibody of HSP72 (SPA 810) was from Stressgen.

Embryo in vitro culture

The neck of pregnant mouse was broken in the afternoon, and the abdominal cavity was then opened immediately afterward. Zygotes surrounded by cumulus cells were found in the upper part of the oviduct (ampulla). The cumulus cells of the oocytes were removed with 0.1% hyaluronidase. The embryos were then washed five times in Hepes-CZB and transfered into CZB microdrops which had been prebalanced for at least 4 h. About 50 embryos were cultured in each microdrop.

Embryo grouping and heat shock in vitro

The mouse blastocysts cultured in vitro were heat treated at 40℃ and 38℃ for 1 h, 2 h and 3 h, respectively, and then were recovered at 37℃ for 3 h, 2 h and 1 h, respectively. The embryos in the control were cultured in 37℃ for 4 h, and the experiments for all the groups of embryos were replicated for three times. The embryos were divided into three groups after treatment and were used for detecting gene expression, HSP72 protein expression. The mouse embryos were cultured to hatched blastocyst stage for study embryonic thermo-sensitivity.

RNA extraction and reverse transcription

The primer of HSP72 gene was 5'-GAAGGTGCTG GACAAGTGC-3' (sense), 5'-GCCAGCAGAGGCC TCTAATC-3' (antisense), and they were synthesizedby TaKaRa (Dalian, China). Total RNA was extracted by Trizol Reagent according to the manufacturer's instructions. cDNA was synthesized from 5 μL of total RNA by using AMV RNA PCR Kit according to the manufacturer's protocol. RT mixture was induced at 42℃ for 1 h, heated to 95℃ for 5 min and then chilled on ice for 5 min. cDNA was stored at –20℃ for the future use. PCR reaction was performed at 94℃ for 1 min for denaturing, 58℃ for 45 s for annealing, and 72℃ for 45 s for extension and was repeated for 30 cycles. PCR products were subjected to electrophoresis of using 1% gel and stained with ethidium bromide solution. The products were ligated to pMD18-T vector and transformed to competent cells of Esherichia coli (DH5α), and the cloned PCR products were sequenced by TaKaRa Company.

Protein sample preparation

About 200 embryos (80 μg of protein) were washed with cold PBS and added in 10 μL 2×SDS sample buffer containing 100 mmol ? L-1Tris HCl, 20 mL ? L-1BME (pH 6.8), 200 mL ? L-1glycerol and 2 mL ? L-1BPB and boiled for 5 min. The samples were stored at–20℃ for the future analysis.

Western blot analysis

The proteins of each lysate were separated by 12% separation gel and 5% stacking gel of SDS-PAGE and then transferred to PVDF membranes. The membranes were first blocked with 5% BSA and treated with mice anti-HSP72 antibody as mentioned above at a dilution of 1 : 500 before being incubated with HRP-conjugated goat anti-mouse IgG. Chemiluminescence method was used to detect the specific immunoreactive protein.

Statistical analysis

The results were expressed as means±SE and the differences between means for two groups were determined by unpaired students t-test. The minimum significance level was set at P≤0.05 for all the analyses. All the experiments were performed at least three times.

Results

PCR products were analyzed through agarose gel electrophoresis and the fragments of DNA with the size of 237 bp were obtained in each group including the control (Fig. 1).

Fig. 1 HSP72 mRNA expression in embryos treated at 38℃ and 40℃ for 1 h to 3 h

ldentification of HSP72 gene clone

Gel extraction of the two bands and the products were ligated to pMD18-T vector and transformed to competent cells of Escherichia coli (DH5α), the positive clones were identified and randomly selected and recombinant plasmid was purified. The results showed that there were two bright fragments with size of 237 bp (Fig. 2).

Fig. 2 PCR identification of positive clone plasmid

Sequencing results and homology analysis

The sequencing results were aligned with HSP72 sequence published in GenBank indicating that the homology between these two sequences was 98.7%,and there were three bases mutated. Sequencing results of the amplified products were as follows: GAAGGT GCTGGACAAGTGCCAGGAGGTCATCTCCTGGC TGGACTCCAACACGCTGGCCGATAAGGAGGA GTTCGTGCACAAGCGGGAGGAGCTGGAGCGG GTGTGCAGCCCCATCATCAGTGGGCTGTACCA GGGTGCGGGTGCTCCTGGGGCTGGGGGCTTCG GGGCCCAGGCGCCGAAAGGAGCCTCTGGCTC AGGACCCACCATCGAGGAGGTGGATTAGAGG CCTCTGCTGGC (the bases underlined were primer). The expression of HSP72 could be detected in all the groups of embryo cultured at 38℃ and significantly (P＜0.05) increased in the embryos with heat shock for 2 h as compared with that in the control, while the expression decreased with the prolongation of the time for heat shock (Fig. 3, Table 1). The expression of HSP72 was detected in all the groups of embryos cultured at 40℃, while there had no significant difference compared with that in the control (P＞0.05, Fig. 4, Table 2).

Fig. 3 Analysis of HSP72 expression in embryos treated at 38℃ for 1 h to 3 h

Fig. 4 Analysis of HSP72 expression in embryos treated at 40℃ for 1 h to 3 h

Table 1 Analysis of HSP72 and Tubulin protein densitometric values in blastocysts treated at 38℃

Table 2 Analysis of HSP72 and Tubulin protein densitometric values in blastocysts treated at 40℃

The hatched blastocyst rate in the group of embryos cultured at 38℃ decreased along with the increase of the time for heat shock and there were significant differences among the groups (P＜0.05, Table 3).

Table 3 Effects of heat shock at 38℃ on embryonic development to hatched blastocyst stage

The hatched blastocyst rate in the groups of embryos cultured at 40℃ also decreased along with time for heat treatment and there were no significant differences between the group of embryos cultured at 40℃ for 2 h and 3 h (P＞0.05), while there were significant differences among other groups (Table 4). However, the hatched blastocyst rates for the blastocyst cultured at 38℃ for 2 h and 3 h for thermal induction of HSP72 before heat shocked at 40℃ for 2 h were 57.74% and 53.36%, respectively, which was significantly higher than that of 47.85% directly heat shocked at 40℃ for 2 h. The hatched blastocyst rate in the induced group of 38℃ for 2 h was the highest (54.74%), which was significantly different with that in the group treated at 40℃ for 2 h (P＜0.05, Table 5).

Table 4 Effects of heat shock at 40℃ on embryonic development to hatched blastocyst stage

Table 5 Effects of induction of thermotolerance on embryoic development to hatched blastocyst stage

Discussion

HSP72 is the most conservative and primary one in the heat shock protein (HSP) family. For the biggest content in majority organism and most significant generation after cell stress, HSP72 gets attentions and is further studied in HSP family. The response for heat shock presents in almost all the prokaryotic and eukaryotic cells. HSP72 is the most sensitive protein in its family to heat shock (Ross et al., 2002; Wu et al., 2004; Zhou et al., 2005), and there is a low level expression of HSP72 in cells under normal condition, but increased expressions with heat shock. The expression of HSP72 reached the highest level when embryos were heat-shocked for 2 h to 4 h, and then it decreased with prolonged time for heat shock as reported by Thayer (Thayer et al., 1997).

The preimplantation bovine embryos are particularly sensitive to heat shock (Krininger et al., 2002; Sakatani et al., 2004; Hansen, 2009), and any changes in the embryonic environment, such as maternal hyperthermia (Edwards et al., 1997), maternal oxidation stress as well as abruptly change of the culture conditions in vitro, can lead to heat shock response of the embryos (Neuer et al., 1999). The results that HSP72 gene was expressed in all the groups of embryos treated from 38℃ for 1 h to 40℃ for 3 h in the present study indicated that a tiny change on culturing temperature led to heat shock response of the embryos in vitro and promoted the expression of HSP72. However, the relationship between HSP72 gene expression and the degree or the strength of heat shock needs further study.

There is an expression of HSP72 starting from zygotic gene activation and its expression is autonomic and undetectable. However, there is an ability of rapid initiate expression as a response to heat shock when the embryo developed to 8-cell to blastocyst stage (Ealy et al., 1994; Zhong et al., 2011). However, in the present study, there was a certain detectable expression of HSP72 in the embryos cultured at 37℃, within thiscircumstance the expression might be induced by the embryonic manipulation during in vitro culture.

HSP72 is relatively conservative in evolution. Cai et al. (2005) reported that there was a high homology among each member of HSP70 family and the homology was higher when the inter species relationship was closer by comparing the amino acid sequence of different species (Garbuz et al., 2011). In our experiment, the sequencing results aligned with HSP72 sequence published in GenBank indicated that the homology between these two sequences was 98.7%, and there were only three bases mutated, which might due to the gene variation of different regions and/or strains of the mice used in the experiment.

In the present study, we found that there were HSP72 expressions in all the groups of embryos cultured at either 38℃ or 40℃. The condition of 38℃for 2 h was the best for inducing HSP72 expression. HSP72 then decreased as the heat shock time prolonged, while the expression of HSP72 under 40℃increased along with the heat shock time and reached the highest level at 3 h. The results agreed generally with that HSP72 mRNA was strongly induced 1 h after exposure to a thermotolerance-inducing temperature of 42℃ in postimplantation rat embryos reported by Thayer et al (1997). The expression of HSP72 was inconspicuousness at 40℃ and this might be caused by over stress or by slow synthesis of HSP72 with the temperature.

Hatching rate decreased in the embryos cultured with elevated temperature and this decrease coincided with duration of heat shock time. This result indicated that heat shock influenced embryonic development. There were two possibilities for this influence. One was that heat shock accelerated HSP72 gene expression which inhibited synthesis of regular protein necessary for maintaining normal cell growth. The other was that the synthesis of denatured proteins was out of the protection of HSP72, which might lead to abnormality of the embryologic development (Germain et al., 1985).

The hatching rate for the embryos with heat shock at 40℃ after induction treatment with mild heat shock at 38℃ was higher than that in the embryos treated directly at 40℃. The results illustrated that the embryonic thermotolerance had produced after mild heat shock at 38℃, while the hatching rate was positively correlated with the expression of HSP72. Because there was the evidence which indicated that HSP72 had certain protection on embryos with heat shock (Ferreira et al., 2011). When embryos suffered from heat shock they increased synthesis of HSP72, while the synthesis of other proteins decreased or terminated temporarily. This newly synthesized HSP72 recognized and bound to unfolded polypeptide chain to prevent its irreversible denaturation and aggregation (Kern et al., 2010). Meanwhile, HSP72 mediated new synthesized polypeptide chain to pierce through the cell membrance as a molecular chaperone (Chalmin et al., 2010; Zheng et al., 2010). After heat shock HSP72 might assist the malfolding proteins to refold or to assemble in correct ways as a role of ATP hydrolysis (Kampinga et al., 2010; Hartl et al., 2011). As the functions of HSP72 detected and mentioned above the reduced proteins were supplemented in time so that the embryos could maintain intracellular homeostasis and HSP72 could also prevent the embryos from the damage caused by protein denaturation and degradation of altered or denatured proteins after heat shock.

The synthesis of HSP72 is corresponding with the severity and duration of heat shock and is not infinite. The mouse embryos show dysplasia or damage of the organelles (Sun et al., 2012) after the severe heat shock with high temperature and long duration. This suggests that heat shock response has a biphasic effect (Leon et al., 2005) according to the severity of the heat shock. It protects the embryos from the damage of severer heat shock, if they are induced with mild heat shock first. The effect of the heat shock on the embryos also depends on the self-regulation of HSP72 expression and the stage of embryonic development when the embryos are sensitive at the early stage of the development (Leon et al., 2005; Volker et al., 2010).

Although there was HSP72 expression in each group of embryos in the present study, the relationship between its expression and the strength of heat shock or the thermotolerance of embryo were not clear now. What was known from the present study was that heat shock decreased the hatching rate of mouse blastocyst and HSP72 had certain degree of protection on embryonic development. Further study on the relationship of HSP72 expression or its gene expression and the embryonic gaining of thermotolerance seems to be necessary. Meanwhile, how to make HSP72 expression reasonably at the embryonic development stage for increasing later thermotolerance of the animals in high temperature environment in the real practice will be meaningful.

Cai Y F, Wang G L, 2005. Point mutation, molecular evolution and prokaryotic expression in E. coli DE3 of bovine HSP70 gene. Acta Zoologica Sinica, 51(6):1080-1090.

Chalmin F, Ladoire S, Mignot G, et al. 2010. Membrane Hsp72 from tumor-derived exosomes mediates pStat3 dependent immunosuppressive function of myeloid derived suppressor cells. Journal of Clinical Investigation, 120(2): 457.

Dastoo R Z, Dreyer J. 2000. Nuclear translocation and aggregate formation of heat shock cognate protein 70 (Hsc70) in oxidative stress and apoptosis. Journal of Cell Science, 113(16): 2845-2854.

Ealy A D, Hansen P J. 1994. Induced thermotolerance during early development of murine and bovine embryo. Journal of Cellular Physiology, 160(3): 463-468.

Edwards J L, Hansen P J. 1997. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Molecular Reproduction and Development, 46: 138-145.

Ferreira R M, Ayres H, Chiaratti M R, et al. 2011. The low fertility of repeat-breeder cows during summer heat stress is related to a low oocyte competence to develop into blastocysts. Journal of Dairy Science, 94: 2383-2392.

Garbuz D G, Yushenova I A, Zatsepina O G, et al. 2011. Organization and evolution of hsp70 clusters strikingly differ in two species of Stratiomyidae (Diptera) inhabiting thermally contrasting environments. BMC Evolutionary Biology, 11: 74.

Garrido C, Schmitt E, Candé C, et al. 2003. HSP27and HSP70: potentially oncogenic apoptosis inhibitors. Cell Cycle, 2: 579-584.

Germain M A, Webster W S, Edwards M J, et al. 1985. Hyperthermia as a teratogen: parameters determining hyperthermia-induced head defects in the rat. Teratology, 31(2): 265-272.

Gupta S, Deepti A, Deegan S, et al. 2010. HSP72 protects cells from ER stress-induced apoptosis via enhancement of IRE1alpha-XBP1 signaling through a physical interaction. PLOS Biology, 8(7): e1000410.

Hansen P J. 2009. Effects of heat stress on mammalian reproduction. Philosophical transactions of the royal society of London. Series B, Biological Sciences, 364: 3341-3350.

Hartl F U, Hayer-Hartl M. 2002. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science, 295(5561): 1852-1858.

Hartl F U, Bracher A, Hayer-Hartl M. 2011. Molecular chaperones in protein folding and proteostasis. Nature, 475: 324-332.

Kampinga H H, Craig E A. 2010. The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nature Reviews Molecular Cell Biology, 11: 579-592.

Kern A, Ackermann B, Clement A M, et al. 2010. HSF1-controlled and age-associated chaperone capacity in neurons and muscle cells of C. elegans. PLOS ONE, 5: e8568.

Krininger III C E, Stephens S H, Hansen P J. 2002. Developmental changes in inhibitory effects of arsenic and heat shock on growth of preimplantation bovine embryos. Molecular Reproduction and Development, 63: 335-340.

Leon L R, DuBose D A, Mason C W. 2005. Heat stress induces a biphasic thermoregulatory response in mice. American journal of physiology-Regulatory Integrative and Comparative Physiology, 288: R197-R204.

Matsuzuka T, Sakamoto N, Ozawa M, et al. 2005. Alleviation of maternal hyperthermia-induced early embryonic death by administration of melatonin to mice. Journal of Pineal Research, 39(3): 217-223.

Morimoto R I, Kline M P, Bimston D N, et al. 1997. The heat-shock response: regulation and function of heat-shock proteins and molecular chaperones. Essays in Biochemistry, 32: 17-29.

Neuer A, Spandorfer S D, Giraldo P, et al. 1999. Heat shock protein expression during gametogenesis and embryogenesis. Infectious Diseases in Obstetrics and Gynecology, 7: 10-16.

Ozawa M, Matsuzuka T, Hirabayashi M, et al. 2004. Redox status of the oviduct and CDC2 activity in 2-cell stage embryos in heat-stressed mice. Biology of Reproduction, 71(1): 291-296.

Rivera R M, Hansen P J. 2001. Development of cultured bovine embryos after exposure to high temperatures in the physiological range. Reproduction, 121(1): 107-115.

Ross O A, Curran M D, Crum K A, et al. 2002. Increased frequency of the 2437 T allele of the heat shock protein 70-Hom genein an aged Irish population. Experimental Gerontology, 38: 561-565.

Sakatani M, Kobayashi S, Takahashi M. 2004. Effects of heat shock on in vitro development and intracellular oxidative state of bovine preimplantation embryos. Molecular Reproduction and Development, 67: 77-82.

Samali A, Orrenius S. 1998. Heat shock proteins: regulators of stress response and apoptosis. Cell Stress Chaperones, 3: 228-236.

Shyu W C, Kao M C, Chou W Y, et al. 2000. Heat shock modulates prion protein expression in human NT-2 Cells. Neuroreport, 11(4): 771-774.

Sun Q, Cong X, Tian W R, et al. 2012. Calcium/calmodulin-dependent protein kinaseⅡcontributes to HSP70 expression in mouse embryonic fibroblasts. Atca Agricultureae Boreali-Simica, 27(4): 213-217.

Tavaria M, Gabriele T, Kola I, et al. 1996. A hitchhiker's guide to the human Hsp70 family. Cell Stress Chaperones, 1: 23-28.

Thayer J M, Mirkes P E. 1997. Induction of Hsp72 and transient nuclear localization of Hsp73 and Hsp72 correlate with the acquisition and loss of thermotolerance in postimplantation rat embryos. Developmental Dynamics, 208(2): 227-243.

Tian W R, Du L Y, He J B, et al. 2004. Inhibition of HSP70 gene expression by modified antisense and its effects on embryonic sensitivity to heat shock. Agriculture Science in China, 3(2): 149-155.

Volker Scheil, Alexandra Zürn, Heinz-R, et al. 2010. Embryo development, stress protein (Hsp70) responses, and histopathology in zebrafish (Danio rerio) following exposure to nickel chloride, chlorpyrifos, and binary mixtures of them. Environmental Toxicology, 25(1): 83.

Wu Y R, Wang C K, Chen C M, et al. 2004. Analysis of heat-shock protein 70 gene polymorphisms and the risk of Parkinson's disease. Human Genetics, 114: 236-241.

Zhang S Z, Wang X P, Liu Y F, et al. 2007. Expression of heat shock protein 70 in human hepatocarcinoma cell line SMMC-7721. Journal of Fourth Military Medical University, 21(9): 1164-1168.

Zheng H, Nagaraja G M, Kaur P, et al. 2010. Chaperokine function of recombinant Hsp72 produced in insect cells using a baculovirus expression system is retained. Journal of Biological Chemistry, 285: 349-356.

Zhong X, Wang T, Zhang X, et al. 2011. Heat shock protein 70 is upregulated in the intestine of intrauterine growth retardation piglets. Cell Stress & Chaperones, 15: 335-342.

Zhou F, Wang F, Li F, et al. 2005. Association of hsp70.2 and hsphom gene polymorphisms with risk of acute high-altitude illness in a Chinese population. Cell Stress & Chaperones, 10: 349-356.

Q954.46

A

1006-8104(2014)-02-0038-08

Received 15 May 2013

Supported by the National Natural Science Foundation of China (31072186; 31172378; 31372313); the Natural Science Foundation of Shandong (ZR2010CM028); SDAIT-12-011-03

Suo Jia-jia (1989-), male, Master, engaged in the research of animal physiology of reproduction. E-mail: huishou535@126.com

* Corresponding author. Tian Wen-ru, professor, supervisor of Ph. D student, engaged in the research of animal physiology of reproduction. E-mail: wrtian@126.com