Hydrogen Sulfide Regulates Ethylene-induced Stomatal Closure in Arabidopsis thaliana

Zhihui Hou,Lanxiang Wang,Jing Liu,Lixia Hou and Xin Liu

College of Life Sciences,Qingdao Agricultural University,University Key Laboratory of Plant Biotechnology in Shandong Province,Qingdao 266109,China

Introduction

Hydrogen sulfide(H2S)is a toxic gas;it is water-soluble,flammable,and has a characteristic odor of rotten eggs(Calvert et al.2010;Matsunami et al.2011).Recent research has revealed that the endogenous gasotransmitter H2S plays important physiological functions like those of nitric oxide(NO)and carbon monoxide(CO)in animal systems(Yong et al.2010).Plants can absorb H2S directly from the atmosphere;H2S can also be synthesized in planta via cysteine degradation catalyzed by D-/L-CDes,or through reducing SO32-by sulfite reductase(Papenbrock et al.2007).The role of H2S in plants has been the focus of increasing attention in recent years.Early studies suggested that the exogenous H2S can improve drought and osmotic stress tolerance in Glycine max L.and Ipomoea batatas L.(Zhang et al.2009a,2010a).Exogenous H2S also was proved that can promote wheat seed germination and alleviates oxidative damage against copper stress(Zhang et al.2008).In Arabidopsis,H2S was shown to function as a signaling molecule by regulating sulfhydryl levels(Riemenschneider et al.2005a).Moreover,H2S plays an important role in photosynthesis regulation by modulating gene expression and thiol redox conditions in Spinacia oleracea(Chen et al.2011).As a signaling molecule with antioxidant activity,H2S was found to alleviate Al3+toxicity during seed germination in Triticum aestivum L.(Zhang et al.2010b),and to protect plants from boron toxicity by counteracting boroninduced up-regulation of cell wall-associated protein pectin methylesterase and expansins(Wang et al.2010).Additionally,H2S was reported to mediate plants’response to osmotic stress by regulating H2O2synthesis(Zhang et al.2009b).In plants,it is known that D-/L-CDes catalyze D-/L-cysteine to generate H2S(Riemenschneider et al.2005a).D-Cysteine desulfhydrase was isolated from Escherichia coli,and the enzyme has a total molecular mass of about 67 kDa,and consists of two subunits identical in molecular mass(Nagasawa et al.1985).The same protein was found in Arabidopsis,and the deduced peptide consists of 401 amino acids and has a molecular mass of 43.9 kDa with a pyridoxal-5′-phosphate binding site(Riemenschneider et al.2005b).However,less was known about the enzyme L-cysteine desulfhydrase.Haruka cloned the L-cysteine desulfhydrase gene from Fusobacterium nucleatum in 2002,revealed that the gene consists of 921 bp and encodes a 33.4 kDa protein.This work also showed that only L-cysteine serves as a substrate for L-cysteine desulfhydrase to produce H2S(Fukamachi et al.2002).

Ethylene is a gaseous phytohormone that plays important roles in many aspects of plant growth,development,and responses to abiotic stresses(Wang et al.2002a;Guo and Ecker 2004).Recently,it was shown that ethylene regulates stomatal movement(Acharya and Assmann 2009;Wilkinson and Davies 2010).For example,exogenous ethylene application promotes stomatal opening,photosynthesis,and plant growth in Brassica juncea L.(Iqbal et al.2011).The signaling crosstalk of ethylene with other phytohormones has also been reported.By regulating ethylene synthesis,indoleacetic acid(IAA)has been shown to induce stomatal opening in Vicia faba L.(Merritt et al.2001).Tanaka et al.(2005,2006)reported that ethylene inhibits abscisic acid(ABA)-induced stomatal closure in Arabidopsis.Moreover,both cytokinin(CTK)and IAA inhibit ABA-induced stomatal closure via regulating ethylene synthesis,and ethylene can induce stomatal closure directly(Gunderson and Taylor 1991;Young et al.2004;Desikan et al.2006).In addition to phytohormones,other signaling molecules such as H2O2,Ca2+,nitrogen monoxide(NO),UV-B,and cytoplasmic alkalinization could be involved in ethylene-induced stomatal signaling,and thus a complex regulatory network exists in plant(Desikan et al.2006;Liu et al.2009,2010;He et al.2011).However,little is known about new signaling molecules,and how the molecules regulate ethylene-induced stomatal signaling is not yet understood.

In guard cells,H2S induces stomatal closure and is involved in ABA-dependent signaling(García-Mata and Lamattina 2010).However,H2S resources,the localization of H2S synthetase in guard cells,and the role of H2S in factors which could cause stomatal closure,such as ethylene and drought,are still unknown.In our study,transgenic Arabidopsis plants of AtD-CDes and AtL-CDes were generated to examine the expression pattern of these two genes in different tissues,and the subcellular localization of AtD-CDes and AtL-CDes in guard cells.Moreover,we tested how the transcription levels of AtD-CDes and AtL-CDes were affected by various factors which could cause stomatal closure.To study the role of H2S in ethylene-induced stomatal movements,the overexpression transgenic lines and the T-DNA-insertion mutants of AtD-CDes and AtL-CDes were investigated.This study provides strong evidence that AtD-CDes and AtL-CDes-mediated H2S play an important role in ethylene-induced stomatal movement.

Results

AtD-CDes and AtL-CDes expression pattern in Arabidopsis seedlings

To study the gene expression of AtD-CDes and AtL-CDes and explore its potential physiological role(s)in plants,the promoter activity of the genes was analyzed byβ-Glucuronidase(GUS)reporter analysis in transgenic Arabidopsis plants expressing the AtD-/L-CDes::GUS constructs.697 bp promoter regions including the 1-UTR of AtD-CDes,and 848 bp promoter regions including the 36-UTR of AtL-CDes,were amplified and cloned into the GUS gene upstream of the pCAMBIA1391 binary vectors,respectively.7-d-old seedlings from AtD-/LCDes::GUS transgenic Arabidopsis plants were analyzed for GUS activity by histochemical analysis.The results showed that AtD-CDes::GUS was highly expressed in leaves(Figure 1A),especially in the leaf vein,mesophyll cells and guard cells(Figure 1B,C).AtD-CDes-related GUS staining was also found in the root vascular tissue and the pericycle(Figure 1D).Moreover,AtL-CDes-related GUS staining was observed in cotyledonary tips(Figure 1E),guard cells(Figure 1F,G)and columella initials(Figure 1H).No staining was detected in the root tip of AtD-CDes::GUS or AtL-CDes::GUS transgenic lines(Figure 1D,H).

Subcellular localization of AtD-CDes and AtL-CDes in Arabidopsis guard cell

Histochemical GUS analysis showed that both AtD-CDes and AtL-CDes are distributed in guard cells(Figure 1C,G).In order to know the subcellular localization of AtD-CDes and AtL-CDes in Arabidopsis guard cells,we constructed the stable expression vectors Modified-p-Super1300-AtD-CDes and Modified-p-Super1300-AtL-CDes.Transgenic Arabidopsis plants were generated by the floral dip method,and the fluorescent fusion proteins AtD-/L-CDes-GFP was examined using confocal laser microscopy(Zeiss LSM510).The results showed that AtD-CDes and AtL-CDes were present in guard cells,which is consistent with the histochemical GUS analysis.AtDCDes are localized in the chloroplast of guard cells(Figure 2C),and AtL-CDes is localized in the cytoplasm(Figure 2E)and in other leaf cells(not shown).In contrast,in the control of the GFP transgenic line,we could only observe a slight background fluorescence from the cell wall of guard cells(Figure 2A).

Figure 1.AtD-CDes and AtL-CDes expression pattern in Arabidopsis seedlings.(A)AtD-CDes::GUS was highly expressed in leaves of Arabidopsis.(B)AtD-CDes::GUS was highly expressed in the leaf vein and mesophyll cells of Arabidopsis.(C)AtD-CDes::GUS was highly expressed in the guard cells of Arabidopsis.(D)AtD-CDes-related GUS staining was found in the root vascular tissue and the pericycle.(E)AtL-CDes-related GUS staining was observed in the cotyledonary tips.(F)AtL-CDes-related GUS staining was observed in leaf vein and guard cells.(G)AtL-CDes-related GUS staining was observed in guard cells.(H)AtL-CDes-related GUS staining was observed in columella initials.Blue staining images of 7-d-old seedlings of transgenic Arabidopsis plants demonstrating the expression patterns of AtD-CDes::GUS and AtL-CDes::GUS.Bars in A and E=500μm;bars in B,D,F and H=100μm;bars in C and G=50μm.

Effects of plant hormones and environmental factors on AtD-CDes and AtL-CDes gene expression in Arabidopsis leaves

Effects of plant hormones on AtD-CDes and AtL-CDes transcription in Arabidopsis leaves

Expression of two Arabidopsis genes,AtD-CDes and AtLCDes,which play key roles in the production of H2S,was detected in guard cells,and the confocal image of AtD-CDes and AtL-CDes showed that these two kinds of proteins are also located in the guard cell.To confirm the involvement of AtD-/L-CDes in regulating stomatal movement,we analyzed the effects of ethylene and other plant hormones that induce stomatal closure on AtD-CDes and AtL-CDes gene expression.Quantitative RT-PCR analysis showed that 10μM of 1-aminocyclopropane-1-carboxylic acid(ACC),a precursor of ethylene,enhanced the transcription of AtD-CDes and AtLCDes,and 50μM ABA,1 mM salicylic acid(SA),and 10μM jasmonic acid(JA)also had the same effects.A maximum gene expression level of AtD-CDes was reached after treatment with ACC for 120 min,ABA for 60 min,SA for 60 min,and JA for 5 min(Figure 3A)(P＜0.05).AtL-CDes gene expression was not increased as significantly as that of AtD-CDes by the ACC treatment;however,the transcription of AtL-CDes was enhanced by ABA treatment for 15 min,SA for 30 min,and JA for 5 min,respectively(Figure 3B)(P＜0.05).It was observed that the transcript levels decreased from the peak over time(Figure 3),suggesting that ethylene,as well as other plant hormones which could induce stomatal closure,might also enhance the gene expression of AtD-CDes and AtL-CDes.Among these plant hormones,ethylene had the most significant effect on the transcription of AtD-CDes(Figure 3A).Additionally,after treatment with all these phytohormones,only ethylene was shown to have a long-term effect on the relative expression of AtL-CDes.

Figure 2.Subcellular localization of Modified-p-Super1300-AtD-CDes and Modified-p-Super1300-AtL-CDes fusion constructs in Arabidopsis thaliana guard cells.(A)GFP alone was localized throughout cells when they were transformed with Modified-p-Super1300-vector control(Dark field).(B)GFP alone was localized throughout cells when they were transformed with Modified-p-Super1300-vector control(Bright field).(C)Subcellular localization of GFP-AtD-CDes fusion protein(Dark field).(D)Subcellular localization of GFP-AtD-CDes fusion protein(Bright field).(E)Subcellular localization of GFP-AtL-CDes fusion protein(Dark field).(F)Subcellular localization of GFP-AtL-CDes fusion protein(Bright field).Confocal images of guard cells were taken from 4-w-old leaves of transgenic Arabidopsis plants expressing GFP-AtD-CDes and GFP-AtLCDes fusion proteins.Bars in A–F=5μm.

Effect of environmental stress on AtD-CDes and AtL-CDes transcription in Arabidopsis leaves

To further understand the role of AtD-/L-CDes in regulating stomatal movement,quantitative RT-PCR analysis was performed to examine the effect of environmental factors which could cause stomatal closure,such as drought(10%PEG),high salinity(150 mM NaCl),and osmotic stresses(100 mM mannitol)on the transcription levels of AtD-CDes and AtLCDes.The results showed that the maximum expression level of AtD-CDes was reached after drought stress for 5 min,salinity for 30 min,and osmotic stress for 60 min,respectively(Figure 4A)(P＜0.05).The AtL-CDes appeared after 30 min of drought treatment,and 15 min of high salinity or osmotic stress(Figure 4B)(P＜0.05).These results indicate that different stresses which can cause stomatal closure,as well as ethylene and other plant hormones,could enhance the expression of the AtD-/L-CDes genes,which play key roles in H2S production.

Figure 3.Effect of plant hormones on AtD-CDes and AtL-CDes transcription in Arabidopsis leaves.(A)Relative expression of AtD-CDes after treated with plant hormones.(B)Relative expression of AtL-CDes after treated with plant hormones.Relative expression of AtD-CDes and AtL-CDes were measured by quantitative RT-PCR analysis after treatment with H2O,10μM 1-aminocyclopropane-1-carboxylic-acid(ACC),50μM abscisic acid(ABA),1 mM salicylic acid(SA)and 10μM jasmonic acid(JA),for 0,5,15,30,60,120,240 min,respectively.Each measurement was repeated in three independent experiments.Error bars indicate standard error of means.

Effects of ethylene on H2S content,D-/L-CDes activity in Arabidopsis

In plants,D-/L-cysteine are resources for generating H2S when catalyzed by D-/L-CDes.Arabidopsis leaves treated with 0.4 mM aminooxy acetic acid(AOA),0.4 mM hydroxylamine(NH2OH)or 0.2 mM potassium pyruvate(C3H3KO3)+0.2 mM ammonia(NH3),were analyzed.The inhibitors of D-/L-CDes alone showed no significant effect on H2S production and D-/L-CDes activity,while treatment with 10μM ACC caused H2S production and D-/L-CDes activity to decrease(Figure 5)(P＜0.05).These results support the notion that D-/L-CDes is involved in ethylene-induced H2S synthesis.

Effects of the H2S synthesis inhibitors on ethylene-induced stomatal closure in Arabidopsis

In order to understand whether H2S is involved in ethyleneinduced stomatal closure,AOA,NH2OH or C3H3KO3+NH3(the inhibitors of D-/L-CDes which were described earlier in this paper),were used with or without ethylene treatment to analyze their effects on stomatal movement.In this study,no significant effect on stomatal aperture was observed under treatments of AOA,NH2OH or C3H3KO3+NH3alone,but treatments that included inhibitors of D-/L-CDes and 10μM ACC significantly inhibited ethylene-induced stomatal closure(Figure 6)(P＜0.05).This observation suggests that the inhibiting effect of stomatal closure induced by ethylene is due to decrease ethylene-induced H2S production.These data provide evidence showing that H2S is involved in ethyleneinduced stomatal closure in Arabidopsis.

Figure 4.Effect of environmental stress on AtD-CDes and AtL-CDes transcription in Arabidopsis leaves.(A)Relative expression of AtD-CDes after treated with environmental stress.(B)Relative expression of AtL-CDes after treated with environmental stress.Relative expression of AtD-CDes(A)and AtL-CDes(B)were measured by quantitative RT-PCR analysis after treatment with H2O,10%polyethylene glycol(PEG 6000),150 mM NaCl,and 100 mM mannitol for 0,5,15,30,60,120,240 min,respectively.Each measurement was repeated in three independent experiments.Error bars indicate standard error of means.

Effects of ethylene on H2S production and stomatal aperture in the leaves of Atd-cdes,Atl-cdes mutants or OED-Cdes,OEL-Cdes overexpression plants

To further examine the function of H2S in ethylene-induced stomatal closure in Arabidopsis,we constructed the overexpression vectors p-Super1300-AtD-CDes and p-Super1300-AtL-CDes,in which cDNAs of AtD-CDes and AtL-CDes were cloned under the 35S promoter.The resulting constructs were confirmed by sequencing,and transferred into Arabidopsis using the flower dip method as described by Clough and Bent(1988).Transgenic lines were selected based on the resistance of transformed plants to kanamycin and rifampicin,and two independent lines from the T3 generation,OED-Cdes,and OEL-Cdes,were obtained and used in our experiments.By using three primers(LB+RP for homozygous lines which were insertions in both chromosomes and LP+RP for wild type which were no insertion,provided by T-DNA Primer Design,http://signal.salk.edu/tdnaprimers.2.html)for SALK lines,the T-DNA insertion mutants were identified,and the obtained homozygotes were used in this study.

As shown in Figure 7A,without application of 10μM ACC,the H2S content in the T-DNA insertion mutants,overexpression plants,and the wild-type Arabidopsis were all at similar levels.A significant effect of ethylene on H2S production was not observed in the T-DNA insertion mutants;however,the overexpression plants were more sensitive to the ethylene treatment(P＜0.05).Similar results are shown in Figure 7B.There was no significant difference among Atd-cdes,Atl-cdes,OED-Cdes,OEL-Cdes and the wild-type in stomatal aperture under the MES treatment.However,compared to the wildtype and the T-DNA insertion mutants,stomatal aperture of the transgenic lines overexpressing AtD-CDes and AtL-CDes were more sensitive to ethylene(P＜0.05).

These results indicated that both AtD-CDes and AtL-CDes positively regulate ethylene-induced stomatal closure and H2S accumulation.

Discussion

Stomata are pores of plant aerial tissues conformed by a pair of guard cells.They play a crucial role in controlling gaseous exchange in terrestrial plants,especially photosynthetic carbon dioxide(CO2)uptake,and water loss by transpiration in response to changes in the surrounding environment.The regulation of the stomatal aperture is extremely important for the survival of plants(He et al.2011).Abnormal stomatal behavior occurs in response to environmental stresses,and it has been documented that ethylene can induce stomatal closure(Desikan et al.2006).Signaling molecules like H2O2,Ca2+,NO and cytoplasmic alkalinization could be all involved in ethylene-induced stomatal signaling(Desikan et al.2006;Liu et al.2009,2010).However,studies to examine new signaling molecules that are involved in ethylene-induced stomatal signaling and the mechanism of ethylene-induced stomatal closure have yet to be performed.

In animals,H2S can act as a signaling molecule similar to the NO and CO,existing and participating in various biological processes(Wang 2002b;Lowicka and Betowski 2007),such as smooth muscle relaxation,neuronal excitability and blood pressure regulation,hippocampal long-term potentiation,brain development,and inflammation(Hosoki et al.1997;Zhao et al.2001;Wang 2002b;Li et al.2006;Yang et al.2008).

Figure 5.Effect of H2S synthesis inhibitors on ethylene regulated H2S levels,and D-CDes and L-CDes activity in Arabidopsis thaliana leaves.(A)H2S content was measured after treated with(yellow)or without(magenta)ACC for different time.(B)H2S content was measured after treated with H2O(a),0.4 mM aminooxy acetic acid(AOA)(b),0.4 mM NH2OH(c),0.2 mM C3H3KO3+0.2 mM NH3(d),along with(yellow)or without(magenta)ACC for 4 h.(C)D-CDes activity was determined after treated as discribled as(B).(D)L-CDes activity was determined after treated as discribled as(B).H2S content was measured using methods described by Sekiya et al.(1982)with slight modifications.D-/L-CDes activity was determined according to Riemenschneide et al.(2005b)with slight modifications and revealed by H2S level.Each measurement was repeated in three independent experiments.Error bars indicate standard error of means.

In plants,both NO and CO are important components of the signaling transduction pathway in stomatal movement(García-Mata and Lamattina 2001;Neill et al.2002;She and Song 2008).As a novel signaling molecule,H2S was reported to cause changes to the stomatal aperture(García-Mata and Lamattina 2010;Lisjak et al.2010).The work of García-Mata and Lamattina(2010)provided evidence to support the notion that H2S could induce the stomatal closure of Arabidopsis,Vicia faba and Impatiens walleriana.Our work,which shows similar results,suggests that exogenous H2S could induce stomatal closure in Arabidopsis(shown in the Supporting Information).H2S induced by NO mediates ethylene-induced stomatal closure in Arabidopsis(Liu et al.2011).It is interesting that Lisjak et al.(2010)observed that H2S induced stomatal opening in Arabidopsis through its scavenging activity of NO.These results suggest that the signaling molecule might have a complicated crosstalk mechanism to regulate stomatal movements,and H2S plays an important role in this process.As described before,there are two kinds of synthetases catalyzing D-/L-cysteine to generate H2S.In order to understand the role of H2S in stomatal closure,further studies should to analyze whether D-/L-cysteine exists in guard cells.The expression patterns of AtD-CDes and AtL-CDes showed us that both of these two genes can be detected in guard cells(Figure 1C,G).To further understand their subcellular localization in the guard cell,we studied the AtD-CDes and AtL-CDes stable expression plants.Our results showed that AtD-CDes localized in the vicinity of the chloroplasts,and AtL-CDes localized in the cytoplasm of the guard cells(Figure 2).In addition,we found that ethylene and other plant hormones that induce stomatal closure also induced AtD-CDes and AtL-CDes expression.Furthermore,we proved that the expression of AtD-CDes and AtL-CDes were affected by drought,high salinity and osmotic stress,the environmental factors that can induce stomatal closure in Arabidopsis(Figure 3,4).These results provide strong evidence for the function of H2S generated from D-/L-CDes in stomatal movements.García-Mata and Lamattina(2010)showed that H2S is involved in ABA-induced stomatal closure.Ethylene can significantly increase H2S generation(Figure 5A,B)and the activity of D-/L-CDes(Figure 5C,D)in Arabidopsis.H2S synthesis inhibitors could weaken the stomatal closure(Figure 6),the content of H2S(Figure 5A,B)and the activity of D-/L-CDes(Figure 5C,D)induced by ethylene,indicating that H2S is involved in the stomatal closure induced by ethylene in Arabidopsis.

Figure 6.Effect of H2S synthesis inhibitors on ethyleneinduced stomatal closure.Epidermises of Arabidopsis were incubated in 2-(N-morpholino)ethanesulfonic acid(MES)buffer(a)and H2S synthesis inhibitors,0.4 mM AOA(b),0.4 mM NH2OH(c),0.2 mM C3H3KO3+0.2 mM NH3(d),along with(yellow)or without(magenta)10μM ACC under light(200μmol/m2/s)for 30 min.The data presented the means of 120 apertures measured per experiment.

Research on the effect and mechanism of H2S as a signaling molecule is just at its beginning stages,and many questions remain about H2S synthesis and signaling pathways.It has been reported that the sources of H2S differ in different parts of animals(Gadalla and Snyder 2010).Furthermore,H2S can regulate Ca2+levels by regulating PKA and PLC/PKC(Yong et al.2010).In the present study,we demonstrate that H2S produced by D-/L-CDes is involved in ethylene-induced stomatal closure.However,many questions remain;for example,is H2S also produced through other pathways other than the D-/L-CDes in guard cells and/or mesophyll cells in Arabidopsis?How does H2S that is generated by various sources respond to upstream signals rapidly and precisely?How is H2S as a signaling molecule being perceived and transported?Research by García-Mata and Lamattina(2010)suggested that H2S is involved in ABA-induced stomatal closure.Figure 1A shows that AtD-CDes gene expression is especially strong in the vascular tissue.Is there any connection between AtD-CDes and the transportation of ABA?No staining was detected in the root tip of AtD-CDes::GUS or AtL-CDes::GUS transgenic lines(Figure 1H),and we surmise that these genes have no effect on Arabidopsis growth.It is not clear why the leaf mesophyll cell shows different expression patterns by the constructs of AtD-CDes::GUS and AtL-CDes::GUS(Figure 1B,F).Moreover,whether Ca2+is involved in H2S-regualted stomatal movement,and whether H2O2,Ca2+,NO and cytoplasmic alkalinization activate the downstream protein kinase and then act on the cytoskeleton-mediated stomatal movement,require further investigation.

Materials and Methods

Plant material and growth conditions

Arabidopsis thaliana(L.)Heynh.ecotype Columbia(Col-0)was used as wild-type throughout this study.Seeds of the Atd-cdes T-DNA insertion line(CS853264),and Atl-cdes T-DNA insertion line(SALK_027027)were obtained from The Arabidopsis Information Resource(TAIR).Seeds were surface sterilized with 10%NaClO and rinsed five times with sterilized water.Sterilized seeds were sown on 0.8%agar plates containing Murashige and Skoog(MS)medium and 1.5%sucrose.Plates were stored at 4°C for 48 h in darkness,and then germinated with roots hanging down from the roof of petri dishes in a tissue culture room at 22°C under a 16 h light/8 h dark photoperiod.After one w,seedlings were transferred to soil and placed in a growth chamber at 22°C with humidity of about 70%under a 16 h light/8 h dark photoperiod.Young,fully-expanded rosette leaves of 4–5 w old plants were used in the experiments.

Figure 7.Effect of ethylene on H2S content and stomatal aperture in the leaves of Atd-cdes,Atl-cdes mutants and overexpression plants AtD-CDes and AtL-CDes.(A)H2S content in leaves was measured after treatment with(yellow)or without(magenta)10μM 1-aminocyclopropane-1-carboxylic-acid(ACC)for 4 h in the wild-type,Atd-cdes,Atl-cdes mutants and overexpression plants OED-Cdes and OEL-Cdes.ACC enhanced the H2S production significantly in overexpression plants than wild type and mutants.(B)Epidermises of wild-type,Atd-cdes,Atl-cdes mutants and overexpression plants OED-Cdes and OEL-Cdes were incubated under light(200μM/m2/s)for 30 min with(yellow)or without(magenta)10μM ACC.Compared to contrast,treatment with ACC induced the stomatal closure significantly in wild type and overexpression plants.Each measurement was repeated in three independent experiments.The data presented the means of 120 apertures measured per experiment.

Stomatal aperture experiments

Stomatal bioassays were performed as described by Liu et al.(2009).Parts of abaxial epidermises were peeled off with sharp forceps from the rosette leaves of 4–5 w old plants and incubated in opening buffer(50 mM KCl,0.1 mM CaCl2and 10 mM MES,pH 6.1)under light conditions(light intensity 200μM/m2/s)for 2 h to open the stomata.For various treatments,epidermal peels with pre-opened stomata were transferred to the same base buffer supplemented with different chemicals for a further 30 min,and then transferred into a drop of floating solution on a glass slide and immediately processed for microscopic analysis of stomatal apertures.

The width of the stomatal aperture was measured under a research microscope equipped with an ocular micrometer.Apertures of ten randomly-selected stomata were measured in each of the three different epidermal strips in each treatment.Each measurement was repeated in three independent experiments.Standard errors were calculated relative to the number of epidermal peel experiments.

Construction of AtD-/L-CDes promoter::GUS fusion and plant transformation

To generate AtD-/L-CDes::GUS transgenic plants,the respective promoter fragments were cloned and fused to the GUS gene in the pCAMBIA-1391 vector.The promoter fragments contained 79 bp of the upstream region of the AtD-CDes gene,and no upstream region was contained in the AtL-CDes promoter respectively.Promoter fragments were amplified by PCR using the following primers:for the AtD-CDes::GUS construct,forward primer 5′-CGGGATCC GAAGATGTGAGTGTATCCATGA TAT-3′,PstI site underlined,and reverse primer 5′-AA CTGCAGTGCTTCTTTCTTCTTCAGTTGTT-3′,BamHI site underlined;AtL-CDes::GUS construct,forward primer 5′-CG GGATCC GTAGAGTTGCTTAAAGAGAAGAAATC-3′, PstI site underlined and reverse primer 5′-AACTGCAGAGGTGA ATATGTTACGGTCACTG-3′,BamHI site underlined.The amplified fragments were sequence-verified and cloned into the pCAMBIA-1391 vector using the restriction enzyme sites PstI and BamHI(TaKaRa,Japan)to generate the AtD-/L-CDes::GUS constructs.The constructs AtD-CDes::GUS and AtL-CDes::GUS were transformed into Agrobacterium tumefaciens strain GV3101.Arabidopsis ecotype Col-0 plants were transformed by the floral dip-method(Clough and Bent 1998),and transformants were selected on MS agar media containing 25μg/mL hygromycin(Hyg).T1 seeds obtained from self-fertilization of primary transformants were surface-sterilized,grown on hygromycin plates,and used to generate homozygous T3 lines that stained for GUS activity according to Lehman et al.(1996).

Histochemical GUS analysis

The histochemical localization of GUS staining in transformed plant organs was assayed according to the methods described by Jefferson(1987).Samples consisted of 7-d-old seedlings,incubated with GUS staining solution(0.4 mg/mL X-Glu(5-bromo-4-chloro-3-indolyl β-D-glucuronide),10 mM phosphate buffer,pH 7.0,0.2 mM potassium ferricyanide,0.2 mM potassium ferrocyanide,0.1%(v/v)Triton X-100,4 mM EDTA)in the dark at 37°C overnight.After incubation,stained plants were cleared with 75%ethanol to remove chlorophyll.Samples were examined for blue staining assessment with a Nikon Inverted Microscope(Ti-S),and were photographed.

Constructs overexpression vector p-Super1300-AtD-CDes and p-Super1300-AtL-CDes

Full-length AtD-CDes cDNA(At1G48420)and AtL-CDes cDNA(At5G65720)were obtained from Tair(http://www.arabidopsis.org/index.jsp).For the transformation,DNA fragments containing the entire coding region were amplified by polymerase chain reaction(PCR)with the oligonucleotide primers(AtD-CDes forward primer,5′-GCTCTAGA ATGAGAGGACGAAGCTT GAC-3′,restriction site XbaI underlined and AtD-CDes reverse primer,5′-GGGTACCCTAGAACATTTTCCCAACACC-3′,restriction site KpnI underlined;AtL-CDes forward primer,5′-GC TCTAGAATGGCGTCTAAGGTAATCTCTG-3′,restriction site XbaI underlined,AtL-CDes reverse primer,5′-GGGGTACC TCAGTGTTGAGACCATTGAAT-3′,restriction site KpnI underlined).Then,the cDNA fragments were inserted into the p-Super1300 vector between restriction sites XbaI and KpnI(TaKaRa,Japan).The fidelity of the constructs was confirmed by restriction digestion and sequence analysis,and the confirmed constructs were named p-Super1300-AtL-CDes and p-Super1300-AtD-CDes,respectively.Subsequently,the two constructs were transformed into Agrobacterium tumefaciens strain GV3101 and selected based on their resistance to kanamycin and rifampicin.The vacuum infiltration method(Clough and Bent 1998)was used to transform the Arabidopsis plants.Several transgenic lines were obtained,and two independent lines from the T3 generation were used in this study.

Quantitative RT-PCR analysis

Total RNA was extracted using the TRIzol reagent(Invitrogen,USA)following the manufacturer’s instructions.For real-time PCR analysis,first-strand cDNA was synthesized from 3μg of total RNA using M-MLV reverse transcriptase(Promega,USA).After synthesis of the first strand cDNA using oligo d(T)18 primer(TaKaRa,Japan),real-time PCR was performed using the MyiQ Real-Time PCR Detection System(Bio-Rad,USA)with the presence of SYBR green I(BioWhittaker Molecular Applications)in the amplification mixture according to the manufacturer’s protocols.Specific primer sets were designed for AtD-CDes(forward primer,5′-ATAGAAGCAGCAAGGGAA-3′,reverse primer,5′-TGAGGCTCTTACTAATGCT-3′);AtLCDes(forward primer,5′-TGTATGTGAGGAGGAGGC-3′,reverse primer,5′-GTTTCATACTGATGCTGCTC-3′)and Atactin(forward primer,5′-GGTAACATTGTGCTCAGTGGTGG-3′,reverse primer,5′-CACGACCTTAATCTTCATGCTGC-3′).The amplification of the actin transcript served as the internal standard,and the data were analyzed with MyiQ software(Bio-Rad,USA).The relative transcript levels of AtD-CDes and AtL-CDes were calculated using the 2-ΔΔCTmethod(Livak and Schmittgen 2001)and standardized with the Atactin transcript level.

H2S level measurement in Arabidopsis leaves

Measurement of H2S emissions was performed as described by Sekiya et al.(1982)with minor modifications.After treatment with 10μM 1-aminocyclopropane-1-carboxylic acid(ACC)for 0,1,2,4,6,8 hours,0.1 g of plant material was ground to a fine powder with liquid nitrogen,and the soluble proteins were extracted by adding 0.9 mL 20 mM Tris-HCl,pH 8.0.After centrifugation,the protein content of the supernatant was adjusted to 100μg/mL to obtain equal amounts of protein in each assay sample.Then,H2S was absorbed by the zinc acetate trap located in the bottom of the test tube.After 30 min at 37°C,100 μL of 30 mM FeCl3dissolved in 1.2 N HCl was added to the trap.100μL 20 mM N,N-dimethylphenylenediamine dihydrochloride dissolved in 7.2 N HCl was then injected into the trap.The amount of H2S in the zinc acetate trap was determined colorimetrically at 670 nm.

Determination of D-/L-CDes activities

The activity of D-/L-CDes was measured according to Riemenschneide et al.(2005).After treatment with 10μM ACC for 4 hours,0.1 g of plant material was ground to a fine powder with liquid nitrogen,and the soluble proteins were extracted by adding 0.9 mL 20 mM Tris-HCl,pH 8.0.After centrifugation,the protein content of the supernatant was adjusted to 100μg/mL to obtain equal amounts of protein in each assay sample.

D-CDes activity was detected by monitoring the release of H2S from D-cysteine in the presence of DTT.The assay contained in a total volume of 1 mL:0.8 mM D-cysteine,2.5 mM DTT,100 mM Tris-HCl,pH 8.0,and 10μg protein solution.The reaction was initiated by the addition of D-cysteine;after incubation for 15 min at 37°C,the reaction was terminated by adding 100μL 30 mM FeCl3dissolved in 1.2 N HCl and 100μL 20 mM N,N-dimethyl-phenylenediamine dihydrochloride dissolved in 7.2 N HCl.The formation of methylene blue was determined at 670 nm.

L-CDes activity was determined in the same way with the following modifications:L-cysteine instead of D-cysteine was used;the pH of the Tris-HCl buffer was 9.0.

Molecular cloning of AtD-/L-CDes-GFP and generation of transgenic plants

To construct a fusion between AtD-/L-CDes and GFP,the AtD-CDes and AtL-CDes CDS were cloned via XbaI and KpnI digestion from pMD18-T-AtD-CDes and pMD18-T-AtL-CDes into a Modified-p-Super1300 vector.In this vector,AtD-/LCDes were placed under the control of CaMV(cauliflower mosaic virus)35S promoter.The primers used to amplify AtD-/L-CDes were as follows:for AtD-CDes(forward primer,5′-GC TCTAGA ATGGATAAGAAGAAGAATTCGTT-3′restriction site XbaI underlined,reverse primer,5′-GGGGTACC GAACATTT TCCCAACACCAT-3′restriction site KpnI underlined)and AtL-CDes (forward primer, 5′-GCTCTAGA ATGGCGTC TAAGGTAATCTC-3′restriction site XbaI underlined,reverse primer,5′-GGGGTACC GTGTTGAGACCATTGAAT-3′restriction site KpnI underlined).All PCR fragments and plasmids were verified by sequencing and restriction digestion.The new constructions are named Modified-p-Super1300-AtD-CDes and Modified-p-Super1300-AtL-CDes.We then transformed the constructs into Arabidopsis wild-type plants by floral dipping using the Agrobacterium stain GV3101,and the method described earlier.

Imaging of AtD-/L-CDes-GFP by confocal microscopy

To determine subcellular localization of AtD-CDes and AtLCDes,epidermal strips were prepared from 4–5 w old AtD-/LCDes-transgenic lines expressing the AtD-/L-CDes-GFP construct.Confocal laser microscopy was carried out to assess AtD-/L-CDes-GFP localization using a Zeiss LSM510 microscope system.Using the 488-nm argon laser with a minimum power setting to excite GFP,the light signal from the samples was captured in complete darkness using a 100×Olympus oil immersion objective,and emission wavelength was measured at a 505-to 550-nm bandpass.Autofluorescence of chloroplasts was used for a comparison.Transmission images were collected in parallel,and were analyzed using the software LSM 5 Image Browser(Zeiss LSM Image Browser 4.2.0.121)(http://corporate.zeiss.com/country-page/en_de/home.html).

Data processing and statistical analysis

The DPS data processing system was used to carry out the significance analysis of the data.Analysis of variance was conducted between different treatments.A P value of＜0.05 was considered statistically significant.

We would like to thank Professor Chunhai Dong(Qingdao Agriculture University)for helpful suggestions,critical reading,and polishing of the manuscript.This study was supported by the National Natural Science Foundation of China(30970228 and 31170237),the National Natural Science Foundation of Shandong Province of China(ZR2010CM024),and the Foundation of The State Key Laboratory of Plant Physiology and Biochemistry(SKLPPBKF11001).

Acharya BR,Assmann SM(2009)Hormone interactions in stomatal function.Plant Mol.Biol.69,451–462.

Calvert JW,Coetzee WA,Lefer DJ(2010)Novel insights into hydrogen sulfide-mediated cytoprotection.Antioxid.Redox Signal.12,1203–1217.

Chen J,Wu FH,Wang WH,Zheng CJ,Lin GH,Dong XJ,He JX,Pei ZM,Zheng HL(2011)Hydrogen sulphide enhances photosynthesis through promoting chloroplast biogenesis,photosynthetic enzyme expression,and thiol redox modification in Spinacia oleracea seedlings.J.Exp.Bot.62,4481–4493.

Clough SJ,Bent AF(1998)Floral dip:A simplified method for agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.6,735–743.

Desikan R,Last K,Harrett-Williams R,Tagliavia C,Harter K,Hooley R,Hancock JT,Neill SJ(2006)Ethylene-induced stomatal closure in Arabidopsis occurs via AtrbohF-mediated hydrogen peroxide synthesis.Plant J.6,907–916.

Fukamachi H,Nakano Y,Yoshimura M,Koga T(2002)Cloning and characterization of the L-cysteine desulfhydrase gene of Fusobacterium nucleatum.FEMS Microbiol.Lett.215,75–80.

García-Mata C,Lamattina L(2001)Nitric oxide induces stomatal closure and enhances the adaptive plant responses against drought stress.Plant Physiol.126,1196–1204.

García-Mata C,Lamattina L(2010)Hydrogen sulphide,a novel gasotransmitter involved in guard cell signalling.New Phytol.188,977–984.

Gadalla MM,Snyder SH(2010)Hydrogen sulfide as a gasotransmitter.J.Neurochem.113,14–26.

Gunderson CA,Taylor GE(1991)Ethylene directly inhibits foliar gasexchange in Glycine max.Plant Physiol.95,337–339.

Guo H,Ecker JR(2004)The ethylene signaling pathway:New insights.Curr.Opin.Plant Biol.7,40–49.

He J,Yue X,Wang R,Zhang Y(2011)Ethylene mediates UVB-induced stomatal closure via peroxidase-dependent hydrogen peroxide synthesis in Vicia faba L.J.Exp.Bot.62,2657–2666.

Hosoki R,Matsuki N,Kimura H(1997)The possible role of hydrogen sulfide as an endogenous smooth muscle relaxant in synergy with nitric oxide.Biochem.Biophys.Res.Commun.237,527–531.

Iqbal N,Nazar R,Syeed S,Masood A,Khan NA(2011)Exogenouslysourced ethylene increases stomatal conductance,photosynthesis,and growth under optimal and deficient nitrogen fertilization in mustard.J.Exp.Bot.62,4955–4963.

Jefferson RA(1987)Assaying chimeric genes in plants:The GUS gene fusion sustem.Plant Mol.Biol.Rep.5,387–405.

Lehman A,Black R,Ecker JR(1996)HOOKLESS1,an ethylene response gene,is required for differential cell elongation in the Arabidopsis hypocotyl.Cell 85,183–194.

Li L,Bhatia M,Moore PK(2006)Hydrogen sulphide–a novel mediator of inflammation?Curr.Opin.Pharmacol.6,125–129.

Lisjak M,Srivastava N,Teklic T,Civale L,Lewandowski K,Wilson I,Wood ME,Whiteman M,Hancock JT(2010)A novel hydrogen sulfide donor causes stomatal opening and reduces nitric oxide accumulation.Plant Physiol.Biochem.48,931–935.

Liu GH,Liu J,Hou LX,Tang J,Liu X(2009)NO may function in the downstream of Ca2+in ethylene induced stomatal closure in Vicia faba L.J.Mol.Cell Biol.42,145–155(in Chinese with an English abstract).

Liu J,Liu GH,Hou LX,Liu X(2010)Ethylene-induced nitric oxide production and stomatal closure in Arabidopsis thaliana depending on changes in cytosolic pH.Chin.Sci.Bull.55,2403–2409.

Livak KJ,Schmittgen TD(2001)Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCtmethod.Methods 25,402–408.

Lowicka E,Betowski J(2007)Hydrogen sulfide(H2S)-the third gas of interest for pharmacologists.Pharmacol.Rep.59,4–24.

Matsunami M,Lirishi S,Okui T,Kawabata A(2011)Chelating luminal zinc mimics hydrogen sulfide-evoked colonic pain in mice:Possible involvement of T-type calcium channels.Neuroscience 181,257–264.

Merritt F,Kemper A,Tallman G(2001)Inhibitors of ethylene biosynthesis inhibit auxin-induced stomatal opening in epidermis detached from leaves of Vicia faba L.Plant Cell Physiol.42,223–230.

Nagasawa T,Ishii T,Kumagai H,Yamada H(1985)D-Cysteine desulfhydrase of Escherichia coli.Purification and characterization.Eur.J.Biochem.153,541–551.

Neill SJ,Desikan R,Clarke A,Hancock JT(2002)Nitric oxide is a novel component of abscisic acid signaling in stomatal guard cells.Plant Physiol.128,13–16.

Papenbrock J,Riemenschneider A,Kamp A,Schulz-Vogt HN,Schmidt A(2007)Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants-from the field to the test tube and back.Plant Biol.(Stuttg)9,582–588.

Riemenschneider A,Nikiforova V,Hoefgen R,De Kok LJ,Papenbrock J(2005a)Impact of elevated H2S on metabolite levels,activity of enzymes and expression of genes involved in cysteine metabolism.Plant Physiol.Biochem.43,473–483.

Riemenschneider A,Wegele R,Schmidt A,Papenbrock J(2005b)Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana.FEBS J.272,1291–1304.

Sekiya J,Schmid TA,Wilson LG,Filer P(1982)Emission of hydrogen sulfide by leaf tissue in response to L-cysteine.Plant Physiol.70,430–436.

She XP,Song XG(2008)Carbon monoxide-induced stomatal closure involves generation of hydrogen peroxide in Vicia faba guard cells.J.Integr.Plant Biol.50,1539–1548.

Tanaka Y,Sano T,Tamaoki M,Nakajima N,Kondo N,Hasezawa S(2006)Cytokinin and auxin inhibit abscisic acid-induced stomatal closure by enhancing ethylene production in Arabidopsis.J.Exp.Bot.57,2259–2266.

Tanaka Y,Sano T,Tamaoki M,Nakajima N,Kondo N,Hasezawa S(2005)Ethylene inhibits abscisic acid-induced stomatal closure in Arabidopsis.Plant Physiol.138,2337–2343.

Wang BL,Shi L,Li YX,Zhang WH(2010)Boron toxicity is alleviated by hydrogen sulfide in cucumber(Cucumis sativus L.)seedlings.Planta 231,1301–1309.

Wang KL,Li H,Ecker JR(2002a)Ethylene biosynthesis and signaling networks.Plant Cell 14,131–151.

Wang R(2002b)Two’s company,three’s a crowd:Can H2S be the third endogenous gaseous transmitter?FASEB J.16,1792–1798.

Wilkinson S,Davies WJ(2010)Drought,ozone,ABA and ethylene:New insights from cell to plant to community.Plant Cell Environ.33,510–525.

Yang G,Wu L,Jiang B,Yang W,Qi J,Cao K,Meng Q,Mustafa AK,Mu W,Zhang S,Snyder SH,Wang R(2008)H2S as a physiologic vasorelaxant:Hypertension in mice with deletion of cystathionine gamma-lyase.Science 322,587–590.

Yong QC,Choo CH,Tan BH,Low CM,Bian JS(2010)Effect of hydrogen sulfide on intracellular calcium homeostasis in neuronal cells.Neurochem.Int.56,508–515.

Young TE,Meeley RB,Gallie DR(2004)ACC synthase expression regulates leaf performance and drought tolerance in maize.Plant J.40,813–825.

Zhang H,Hu LY,Hu KD,He YD,Wang SH,Luo JP(2008)Hydrogen sulfide promotes wheat seed germination and alleviates oxidative damage against copper stress.J.Integr.Plant Biol.50,1518–1529.

Zhang H,Tang J,Liu XP,Wang Y,Yu W,Peng WY,Fang F,Ma DF,Wei ZJ,Hu LY(2009a)Hydrogen sulfide promotes root organogenesis in Ipomoea batatas,Salix matsudana and Glycine max.J.Integr.Plant Biol.51,1086–1094.

Zhang H,Ye YK,Wang SH,Luo JP,Tang J,Ma DF(2009b)Hydrogen sulfide counteracts chlorophyll loss in sweet potato seedling leaves and alleviates oxidative damage against osmotic stress.Plant Growth Regul.58,243–250.

Zhang H,Jiao H,Jiang CX,Wang SH,Wei ZJ,Luo JP,Jones RL(2010a)Hydrogen sulfide protects soybean seedlings against drought-induced oxidative stress.Acta Physiol.Plant 32,849–857.

Zhang H,Tan ZQ,Hu LY,Wang SH,Luo JP,Jones RL(2010b)Hydrogen sulfide alleviates aluminum toxicity in germinating wheat seedlings.J.Integr.Plant Biol.52,556–567.

Zhao W,Zhang J,Lu Y,Wang R(2001)The vasorelaxant effect of H2S as a novel endogenous gaseous KATPchannel opener.EMBO J.20,6008–6016.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1.Effects of different concentrations of NaHS on stomatal closure in Arabidopsis.

(A)0 mmol/L.

(B)0.05 mmol/L.

(C)0.1 mmol/L.

(D)0.2 mmol/L.

Figure S2.Subcellular localization of GFP-AtD-CDes fusion protein in Arabidopsis thaliana guard cell.

Autofluorescence of chloroplast was red and the fluorescence of GFP was green as shown in the images.

Figure S3.Localization of Modified-p-Super1300-AtD-CDes fusion constructs in Arabidopsis thaliana leaves.

GFP-AtD-CDes fusion proteins(green light dots)were shown in guard cells and some other leaf cells.

Figure S4.Quantitative real-time PCR analysis of AtD-CDes overexpressing plant(A)and AtL-CDes overexpressing plant(B).

Figure S5.Quantitative real-time PCR analysis of AtDCDes T-DNA-insertion mutants(A)and AtL-CDes T-DNA-insertion mutants(B).